Incidental Mutation 'R7586:Fbrsl1'
ID587130
Institutional Source Beutler Lab
Gene Symbol Fbrsl1
Ensembl Gene ENSMUSG00000043323
Gene Namefibrosin-like 1
Synonyms2410025L10Rik, LOC381668
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R7586 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110361754-110448503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110378154 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 61 (F61V)
Ref Sequence ENSEMBL: ENSMUSP00000143147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056124] [ENSMUST00000069483] [ENSMUST00000196801] [ENSMUST00000198768] [ENSMUST00000198834]
Predicted Effect probably damaging
Transcript: ENSMUST00000056124
AA Change: F61V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054613
Gene: ENSMUSG00000043323
AA Change: F61V

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 125 329 3.1e-96 PFAM
low complexity region 464 480 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069483
AA Change: F475V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063879
Gene: ENSMUSG00000043323
AA Change: F475V

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 476 493 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Pfam:Auts2 564 767 1.9e-95 PFAM
low complexity region 902 918 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
low complexity region 966 980 N/A INTRINSIC
low complexity region 981 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196801
SMART Domains Protein: ENSMUSP00000142625
Gene: ENSMUSG00000043323

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 447 456 N/A INTRINSIC
low complexity region 489 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198768
SMART Domains Protein: ENSMUSP00000142379
Gene: ENSMUSG00000043323

DomainStartEndE-ValueType
low complexity region 17 38 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198834
AA Change: F61V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143147
Gene: ENSMUSG00000043323
AA Change: F61V

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 150 353 4.1e-107 PFAM
low complexity region 488 504 N/A INTRINSIC
low complexity region 522 537 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,793 N446Y possibly damaging Het
Ankdd1a C T 9: 65,502,184 probably null Het
Ankrd31 A G 13: 96,832,054 E733G possibly damaging Het
Cars2 C T 8: 11,530,321 W239* probably null Het
Catsperz A T 19: 6,922,561 L192* probably null Het
Cdh3 T C 8: 106,511,343 probably null Het
Cfh C T 1: 140,147,721 V260M probably damaging Het
Clcn4 T A 7: 7,293,959 S227C probably benign Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Col27a1 C A 4: 63,225,041 A322D probably damaging Het
Egflam C T 15: 7,208,601 G934S probably damaging Het
Eloa A G 4: 136,007,199 V665A probably damaging Het
Epg5 A G 18: 78,030,060 T2433A probably benign Het
Ercc5 A G 1: 44,175,851 N848S possibly damaging Het
Fry T C 5: 150,426,218 Y1595H probably damaging Het
Fstl4 A G 11: 53,072,429 N213D probably benign Het
Gab2 C T 7: 97,301,438 P446L probably damaging Het
Ganab A T 19: 8,911,352 Y552F possibly damaging Het
Gfy C T 7: 45,177,538 R378Q probably damaging Het
Gm3285 T C 10: 77,862,041 V8A unknown Het
Gm8251 G A 1: 44,060,013 R642W probably benign Het
Grip1 A T 10: 120,077,138 probably null Het
Gtf3c3 A G 1: 54,403,593 L764P probably damaging Het
Igfbp2 A T 1: 72,849,148 M150L probably benign Het
Jakmip2 C T 18: 43,540,611 R796Q probably damaging Het
Jpt1 T A 11: 115,498,195 R141W probably damaging Het
Junb T C 8: 84,978,173 E86G probably damaging Het
Klhl41 A T 2: 69,674,724 D457V probably benign Het
Lama2 T C 10: 27,101,393 Y1930C probably benign Het
Med13 A T 11: 86,271,002 I2167N probably damaging Het
Msh3 A G 13: 92,349,332 probably benign Het
Myo1b A C 1: 51,778,324 I593S probably damaging Het
Myo1c A T 11: 75,657,519 T16S possibly damaging Het
Ndufaf4 C T 4: 24,901,829 L126F probably damaging Het
Nlrp9a A T 7: 26,557,296 N113I possibly damaging Het
Olfr1000 G C 2: 85,608,184 S242C probably damaging Het
Olfr1173 T A 2: 88,274,450 I200F probably damaging Het
Olfr478 T A 7: 108,031,921 T141S probably benign Het
Pabpc6 A T 17: 9,668,682 D313E probably damaging Het
Pcdhb2 G T 18: 37,295,804 G277* probably null Het
Phkb T G 8: 86,029,597 V840G probably damaging Het
Pip4k2c A G 10: 127,199,086 F415S probably damaging Het
Ptprb A G 10: 116,343,874 E1112G probably damaging Het
Pum2 A G 12: 8,747,206 D847G probably damaging Het
Qrich2 C T 11: 116,455,624 R1458H probably benign Het
Rdh11 T C 12: 79,185,183 Y199C probably damaging Het
Scamp3 A G 3: 89,180,366 Y171C probably damaging Het
Serpinb9b T C 13: 33,039,760 S312P probably damaging Het
Slain2 G A 5: 72,965,822 S461N probably benign Het
Slc23a1 G A 18: 35,625,838 T100I probably damaging Het
Spata31d1b T A 13: 59,718,380 I1114N probably damaging Het
Spinkl A G 18: 44,174,589 S2P probably damaging Het
Srrt T C 5: 137,302,195 N173S probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Supt16 A T 14: 52,173,556 V697E probably damaging Het
Taf6l C T 19: 8,783,846 E53K probably damaging Het
Tmem81 A T 1: 132,507,773 I106F probably damaging Het
Tnxb C A 17: 34,716,408 L2561I probably damaging Het
Top3b G A 16: 16,891,368 R640H probably benign Het
Trpm7 A T 2: 126,810,165 S1463T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tubal3 A C 13: 3,928,198 D38A possibly damaging Het
Vps13a T A 19: 16,647,598 I2766F probably benign Het
Wwc1 A T 11: 35,844,195 V951E possibly damaging Het
Zfp777 A T 6: 48,029,218 M414K probably benign Het
Other mutations in Fbrsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fbrsl1 APN 5 110378248 missense probably damaging 0.99
IGL01743:Fbrsl1 APN 5 110381640 missense probably damaging 0.98
IGL01910:Fbrsl1 APN 5 110363736 missense probably damaging 1.00
F5770:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
FR4342:Fbrsl1 UTSW 5 110378125 small insertion probably benign
FR4589:Fbrsl1 UTSW 5 110378150 small insertion probably benign
R0084:Fbrsl1 UTSW 5 110379515 missense probably damaging 0.99
R0126:Fbrsl1 UTSW 5 110396040 splice site probably benign
R0336:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R1196:Fbrsl1 UTSW 5 110374519 missense probably benign 0.21
R1712:Fbrsl1 UTSW 5 110447996 missense probably benign 0.01
R1998:Fbrsl1 UTSW 5 110376439 missense probably benign 0.43
R2081:Fbrsl1 UTSW 5 110371625 critical splice acceptor site probably null
R2108:Fbrsl1 UTSW 5 110378434 missense probably damaging 0.97
R4420:Fbrsl1 UTSW 5 110378986 missense possibly damaging 0.66
R4472:Fbrsl1 UTSW 5 110379066 start gained probably benign
R4931:Fbrsl1 UTSW 5 110379029 missense possibly damaging 0.89
R4994:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R5025:Fbrsl1 UTSW 5 110417901 missense probably damaging 0.99
R5084:Fbrsl1 UTSW 5 110379406 start gained probably benign
R5326:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5542:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5590:Fbrsl1 UTSW 5 110381618 missense probably damaging 0.96
R6168:Fbrsl1 UTSW 5 110396056 missense probably damaging 0.97
R6234:Fbrsl1 UTSW 5 110378051 missense probably damaging 0.97
R6325:Fbrsl1 UTSW 5 110377407 missense probably damaging 1.00
R6661:Fbrsl1 UTSW 5 110378097 missense probably damaging 1.00
R7269:Fbrsl1 UTSW 5 110433014 missense probably benign 0.15
R7514:Fbrsl1 UTSW 5 110432933 missense probably benign 0.06
R7791:Fbrsl1 UTSW 5 110448019 missense probably benign 0.00
RF008:Fbrsl1 UTSW 5 110378118 small insertion probably benign
RF029:Fbrsl1 UTSW 5 110378139 small insertion probably benign
RF031:Fbrsl1 UTSW 5 110378151 small insertion probably benign
RF033:Fbrsl1 UTSW 5 110378125 small insertion probably benign
RF034:Fbrsl1 UTSW 5 110378149 small insertion probably benign
RF037:Fbrsl1 UTSW 5 110378151 nonsense probably null
RF061:Fbrsl1 UTSW 5 110378131 small insertion probably benign
RF063:Fbrsl1 UTSW 5 110378139 small insertion probably benign
RF063:Fbrsl1 UTSW 5 110378143 small insertion probably benign
RF064:Fbrsl1 UTSW 5 110378131 small insertion probably benign
V7582:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0018:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0019:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0020:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0021:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0022:Fbrsl1 UTSW 5 110371549 missense probably damaging 1.00
X0022:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0023:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0024:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0027:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0050:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0052:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0053:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0054:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0057:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0058:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0060:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0061:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0062:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0063:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0064:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0065:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0066:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0067:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTGTGTACGACTCCCTGTC -3'
(R):5'- ATTGGTACTTGGTCACAGGCTC -3'

Sequencing Primer
(F):5'- GTACGACTCCCTGTCCCACC -3'
(R):5'- AGTGCCAGGTGACTATCCG -3'
Posted On2019-10-24