Incidental Mutation 'R7586:Ankrd31'
ID587164
Institutional Source Beutler Lab
Gene Symbol Ankrd31
Ensembl Gene ENSMUSG00000109561
Gene Nameankyrin repeat domain 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7586 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location96748272-96910039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96832054 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 733 (E733G)
Ref Sequence ENSEMBL: ENSMUSP00000146720 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000207464
AA Change: E583G
Predicted Effect possibly damaging
Transcript: ENSMUST00000208758
AA Change: E733G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,793 N446Y possibly damaging Het
Ankdd1a C T 9: 65,502,184 probably null Het
Cars2 C T 8: 11,530,321 W239* probably null Het
Catsperz A T 19: 6,922,561 L192* probably null Het
Cdh3 T C 8: 106,511,343 probably null Het
Cfh C T 1: 140,147,721 V260M probably damaging Het
Clcn4 T A 7: 7,293,959 S227C probably benign Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Col27a1 C A 4: 63,225,041 A322D probably damaging Het
Egflam C T 15: 7,208,601 G934S probably damaging Het
Eloa A G 4: 136,007,199 V665A probably damaging Het
Epg5 A G 18: 78,030,060 T2433A probably benign Het
Ercc5 A G 1: 44,175,851 N848S possibly damaging Het
Fbrsl1 A C 5: 110,378,154 F61V probably damaging Het
Fry T C 5: 150,426,218 Y1595H probably damaging Het
Fstl4 A G 11: 53,072,429 N213D probably benign Het
Gab2 C T 7: 97,301,438 P446L probably damaging Het
Ganab A T 19: 8,911,352 Y552F possibly damaging Het
Gfy C T 7: 45,177,538 R378Q probably damaging Het
Gm3285 T C 10: 77,862,041 V8A unknown Het
Gm8251 G A 1: 44,060,013 R642W probably benign Het
Grip1 A T 10: 120,077,138 probably null Het
Gtf3c3 A G 1: 54,403,593 L764P probably damaging Het
Igfbp2 A T 1: 72,849,148 M150L probably benign Het
Jakmip2 C T 18: 43,540,611 R796Q probably damaging Het
Jpt1 T A 11: 115,498,195 R141W probably damaging Het
Junb T C 8: 84,978,173 E86G probably damaging Het
Klhl41 A T 2: 69,674,724 D457V probably benign Het
Lama2 T C 10: 27,101,393 Y1930C probably benign Het
Med13 A T 11: 86,271,002 I2167N probably damaging Het
Msh3 A G 13: 92,349,332 probably benign Het
Myo1b A C 1: 51,778,324 I593S probably damaging Het
Myo1c A T 11: 75,657,519 T16S possibly damaging Het
Ndufaf4 C T 4: 24,901,829 L126F probably damaging Het
Nlrp9a A T 7: 26,557,296 N113I possibly damaging Het
Olfr1000 G C 2: 85,608,184 S242C probably damaging Het
Olfr1173 T A 2: 88,274,450 I200F probably damaging Het
Olfr478 T A 7: 108,031,921 T141S probably benign Het
Pabpc6 A T 17: 9,668,682 D313E probably damaging Het
Pcdhb2 G T 18: 37,295,804 G277* probably null Het
Phkb T G 8: 86,029,597 V840G probably damaging Het
Pip4k2c A G 10: 127,199,086 F415S probably damaging Het
Ptprb A G 10: 116,343,874 E1112G probably damaging Het
Pum2 A G 12: 8,747,206 D847G probably damaging Het
Qrich2 C T 11: 116,455,624 R1458H probably benign Het
Rdh11 T C 12: 79,185,183 Y199C probably damaging Het
Scamp3 A G 3: 89,180,366 Y171C probably damaging Het
Serpinb9b T C 13: 33,039,760 S312P probably damaging Het
Slain2 G A 5: 72,965,822 S461N probably benign Het
Slc23a1 G A 18: 35,625,838 T100I probably damaging Het
Spata31d1b T A 13: 59,718,380 I1114N probably damaging Het
Spinkl A G 18: 44,174,589 S2P probably damaging Het
Srrt T C 5: 137,302,195 N173S probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Supt16 A T 14: 52,173,556 V697E probably damaging Het
Taf6l C T 19: 8,783,846 E53K probably damaging Het
Tmem81 A T 1: 132,507,773 I106F probably damaging Het
Tnxb C A 17: 34,716,408 L2561I probably damaging Het
Top3b G A 16: 16,891,368 R640H probably benign Het
Trpm7 A T 2: 126,810,165 S1463T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tubal3 A C 13: 3,928,198 D38A possibly damaging Het
Vps13a T A 19: 16,647,598 I2766F probably benign Het
Wwc1 A T 11: 35,844,195 V951E possibly damaging Het
Zfp777 A T 6: 48,029,218 M414K probably benign Het
Other mutations in Ankrd31
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6001:Ankrd31 UTSW 13 96826209 missense probably damaging 1.00
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6273:Ankrd31 UTSW 13 96851673 missense possibly damaging 0.61
R6291:Ankrd31 UTSW 13 96878238 missense possibly damaging 0.72
R6387:Ankrd31 UTSW 13 96830573 missense probably damaging 0.99
R6608:Ankrd31 UTSW 13 96832780 missense probably damaging 0.99
R6680:Ankrd31 UTSW 13 96830609 critical splice donor site probably null
R6738:Ankrd31 UTSW 13 96904127 missense possibly damaging 0.79
R6860:Ankrd31 UTSW 13 96831586 missense probably benign 0.01
R6988:Ankrd31 UTSW 13 96878249 missense probably damaging 1.00
R7305:Ankrd31 UTSW 13 96878971 missense probably damaging 0.99
R7631:Ankrd31 UTSW 13 96878954 missense probably benign 0.04
R7842:Ankrd31 UTSW 13 96821458 critical splice donor site probably null
R7890:Ankrd31 UTSW 13 96831871 missense probably benign 0.27
R7911:Ankrd31 UTSW 13 96879100 missense possibly damaging 0.47
R8052:Ankrd31 UTSW 13 96832528 missense probably benign 0.07
R8133:Ankrd31 UTSW 13 96866495 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCTGTCAAGCTTGGAAAATGG -3'
(R):5'- CTCTTCGTGATGATCATGGCTC -3'

Sequencing Primer
(F):5'- CTGTCAAGCTTGGAAAATGGTATAG -3'
(R):5'- CATGCCTTCTTTTGGAGATGC -3'
Posted On2019-10-24