Incidental Mutation 'R7586:Supt16'
ID 587165
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R7586 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52173556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 697 (V697E)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: V697E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V697E

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,793 N446Y possibly damaging Het
Ankdd1a C T 9: 65,502,184 probably null Het
Ankrd31 A G 13: 96,832,054 E733G possibly damaging Het
Cars2 C T 8: 11,530,321 W239* probably null Het
Catsperz A T 19: 6,922,561 L192* probably null Het
Cdh3 T C 8: 106,511,343 probably null Het
Cfh C T 1: 140,147,721 V260M probably damaging Het
Clcn4 T A 7: 7,293,959 S227C probably benign Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Col27a1 C A 4: 63,225,041 A322D probably damaging Het
Egflam C T 15: 7,208,601 G934S probably damaging Het
Eloa A G 4: 136,007,199 V665A probably damaging Het
Epg5 A G 18: 78,030,060 T2433A probably benign Het
Ercc5 A G 1: 44,175,851 N848S possibly damaging Het
Fbrsl1 A C 5: 110,378,154 F61V probably damaging Het
Fry T C 5: 150,426,218 Y1595H probably damaging Het
Fstl4 A G 11: 53,072,429 N213D probably benign Het
Gab2 C T 7: 97,301,438 P446L probably damaging Het
Ganab A T 19: 8,911,352 Y552F possibly damaging Het
Gfy C T 7: 45,177,538 R378Q probably damaging Het
Gm3285 T C 10: 77,862,041 V8A unknown Het
Gm8251 G A 1: 44,060,013 R642W probably benign Het
Grip1 A T 10: 120,077,138 probably null Het
Gtf3c3 A G 1: 54,403,593 L764P probably damaging Het
Igfbp2 A T 1: 72,849,148 M150L probably benign Het
Jakmip2 C T 18: 43,540,611 R796Q probably damaging Het
Jpt1 T A 11: 115,498,195 R141W probably damaging Het
Junb T C 8: 84,978,173 E86G probably damaging Het
Klhl41 A T 2: 69,674,724 D457V probably benign Het
Lama2 T C 10: 27,101,393 Y1930C probably benign Het
Med13 A T 11: 86,271,002 I2167N probably damaging Het
Msh3 A G 13: 92,349,332 probably benign Het
Myo1b A C 1: 51,778,324 I593S probably damaging Het
Myo1c A T 11: 75,657,519 T16S possibly damaging Het
Ndufaf4 C T 4: 24,901,829 L126F probably damaging Het
Nlrp9a A T 7: 26,557,296 N113I possibly damaging Het
Olfr1000 G C 2: 85,608,184 S242C probably damaging Het
Olfr1173 T A 2: 88,274,450 I200F probably damaging Het
Olfr478 T A 7: 108,031,921 T141S probably benign Het
Pabpc6 A T 17: 9,668,682 D313E probably damaging Het
Pcdhb2 G T 18: 37,295,804 G277* probably null Het
Phkb T G 8: 86,029,597 V840G probably damaging Het
Pip4k2c A G 10: 127,199,086 F415S probably damaging Het
Ptprb A G 10: 116,343,874 E1112G probably damaging Het
Pum2 A G 12: 8,747,206 D847G probably damaging Het
Qrich2 C T 11: 116,455,624 R1458H probably benign Het
Rdh11 T C 12: 79,185,183 Y199C probably damaging Het
Scamp3 A G 3: 89,180,366 Y171C probably damaging Het
Serpinb9b T C 13: 33,039,760 S312P probably damaging Het
Slain2 G A 5: 72,965,822 S461N probably benign Het
Slc23a1 G A 18: 35,625,838 T100I probably damaging Het
Spata31d1b T A 13: 59,718,380 I1114N probably damaging Het
Spinkl A G 18: 44,174,589 S2P probably damaging Het
Srrt T C 5: 137,302,195 N173S probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Taf6l C T 19: 8,783,846 E53K probably damaging Het
Tmem81 A T 1: 132,507,773 I106F probably damaging Het
Tnxb C A 17: 34,716,408 L2561I probably damaging Het
Top3b G A 16: 16,891,368 R640H probably benign Het
Trpm7 A T 2: 126,810,165 S1463T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tubal3 A C 13: 3,928,198 D38A possibly damaging Het
Vps13a T A 19: 16,647,598 I2766F probably benign Het
Wwc1 A T 11: 35,844,195 V951E possibly damaging Het
Zfp777 A T 6: 48,029,218 M414K probably benign Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- TCAAAGTCACTAGCCTACTGTAC -3'
(R):5'- TGGACTGTAGCTTCCCAGAG -3'

Sequencing Primer
(F):5'- TCATGTTTTTAAAAACCTCTTTACCG -3'
(R):5'- CTGTAGCTTCCCAGAGTAGAACATG -3'
Posted On 2019-10-24