Mutagenetix > Incidental Mutations

Incidental Mutation 'R0622:Proser1'

58717

Institutional Source

Beutler Lab

Gene Symbol

Proser1

Ensembl Gene

ENSMUSG00000049504

Gene Name

proline and serine rich 1

Synonyms

2810046L04Rik

MMRRC Submission

038811-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0622 (G1)

Quality Score

205

Status

Not validated

Chromosome

Chromosomal Location

53463666-53481755 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53477860 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 388 (S388G)

Ref Sequence

ENSEMBL: ENSMUSP00000055253 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058577]

AlphaFold

Q5PRE5

Predicted Effect

probably benign
Transcript: ENSMUST00000058577
AA Change: S388G

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000055253
Gene: ENSMUSG00000049504
AA Change: S388G

Domain	Start	End	E-Value	Type
Pfam:DUF4476	1	63	5e-12	PFAM
Pfam:DUF4476	30	121	4e-27	PFAM
low complexity region	227	246	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	302	316	N/A	INTRINSIC
low complexity region	321	331	N/A	INTRINSIC
low complexity region	335	357	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	696	718	N/A	INTRINSIC
low complexity region	781	804	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
low complexity region	820	834	N/A	INTRINSIC
low complexity region	854	880	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200328

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein containing proline and serine rich regions. These regions may be important in protein-protein interactions. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtr1a	T	A	13: 30,381,681	M243K	probably benign	Het
Ap1b1	A	G	11: 5,037,707	M744V	probably damaging	Het
C87977	T	C	4: 144,213,013		probably benign	Het
Ccdc152	T	C	15: 3,298,178	N39S	probably damaging	Het
Cd163	G	A	6: 124,317,352	V490M	probably damaging	Het
Col6a5	G	T	9: 105,925,852	H1305N	unknown	Het
Cpb1	C	A	3: 20,249,818	D361Y	probably damaging	Het
Dchs1	T	A	7: 105,763,449	Y1248F	probably damaging	Het
Dhdds	G	C	4: 133,994,236	F83L	probably damaging	Het
Dsg4	T	A	18: 20,449,788	V161E	possibly damaging	Het
Exosc4	A	G	15: 76,327,536	D15G	probably damaging	Het
F3	A	T	3: 121,725,019	D44V	probably damaging	Het
Fat2	A	T	11: 55,283,128	F2253Y	probably damaging	Het
Fbn1	T	C	2: 125,379,024	D650G	possibly damaging	Het
Gramd4	T	A	15: 86,091,389	F36I	probably damaging	Het
Grm7	G	A	6: 111,358,496	A623T	probably damaging	Het
Gys1	A	T	7: 45,439,995	T193S	probably damaging	Het
Hectd4	A	G	5: 121,348,625	T3228A	possibly damaging	Het
Itpk1	G	T	12: 102,573,980	D281E	probably damaging	Het
Kcnh7	A	C	2: 62,837,289		probably null	Het
Klhl29	A	G	12: 5,081,224	L852P	probably damaging	Het
Lrch1	T	C	14: 74,796,051	Y509C	probably benign	Het
Lrp1b	A	G	2: 41,728,551		probably null	Het
Mcpt4	C	A	14: 56,060,662	R144L	probably benign	Het
Mia2	C	T	12: 59,131,578	R12W	probably damaging	Het
Mrps5	A	G	2: 127,594,531	K116R	probably benign	Het
Myrf	G	A	19: 10,223,452	P286S	probably damaging	Het
Nanp	A	G	2: 151,039,244	M28T	probably benign	Het
Neb	T	C	2: 52,212,951	I4472V	probably benign	Het
Nfix	A	C	8: 84,726,482	N314K	probably damaging	Het
Nlrc3	C	T	16: 3,953,968	R849Q	probably benign	Het
Nup210l	G	A	3: 90,167,740	V786M	probably damaging	Het
Olfr1346	T	C	7: 6,474,599	I163T	possibly damaging	Het
Olfr314	T	C	11: 58,786,341	S36P	probably damaging	Het
Olfr600	A	G	7: 103,346,857	S24P	probably damaging	Het
Olfr898	A	G	9: 38,349,371	N96S	possibly damaging	Het
Pdia4	A	T	6: 47,806,518	F197Y	probably damaging	Het
Phldb1	T	C	9: 44,715,852	D432G	probably damaging	Het
Pik3ca	A	G	3: 32,436,552	E116G	probably damaging	Het
Polq	T	C	16: 37,060,993	V1173A	probably benign	Het
Pou2f3	C	T	9: 43,125,119	R423H	probably damaging	Het
Prkag2	T	C	5: 24,869,249	N246S	probably damaging	Het
Ralgps1	G	A	2: 33,174,447	R238*	probably null	Het
Rfx2	T	C	17: 56,777,071	D657G	probably damaging	Het
Ryr3	A	G	2: 112,662,555	F3724S	probably damaging	Het
Sh2d5	T	C	4: 138,259,228	S421P	probably damaging	Het
Slc17a2	C	A	13: 23,812,611	T33K	probably damaging	Het
St8sia5	A	G	18: 77,246,113	T156A	probably damaging	Het
Stk32c	T	C	7: 139,188,110	D85G	probably benign	Het
Tnks	A	G	8: 34,940,822	S251P	probably damaging	Het
Tnxb	T	A	17: 34,718,729	L3864Q	probably damaging	Het
Trim9	A	G	12: 70,346,604	Y189H	probably damaging	Het
Vmn1r77	T	G	7: 12,041,388	F30L	probably benign	Het
Wasf3	A	G	5: 146,466,792		probably null	Het
Wdr90	C	T	17: 25,855,658	C603Y	probably damaging	Het
Zdhhc25	T	C	15: 88,601,107	L215P	probably damaging	Het
Zeb1	C	T	18: 5,759,123	Q140*	probably null	Het
Zfp677	C	T	17: 21,397,700	L340F	probably benign	Het

Other mutations in Proser1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02035:Proser1	APN	3	53478830	missense	probably benign	0.00
IGL02217:Proser1	APN	3	53471491	missense	probably damaging	0.96
IGL02260:Proser1	APN	3	53478944	missense	probably damaging	1.00
IGL02943:Proser1	APN	3	53479103	missense	probably damaging	0.98
donatello	UTSW	3	53467151	missense	probably damaging	1.00
R0166:Proser1	UTSW	3	53480617	missense	possibly damaging	0.89
R0230:Proser1	UTSW	3	53478962	missense	probably damaging	0.99
R0579:Proser1	UTSW	3	53467151	missense	probably damaging	1.00
R0599:Proser1	UTSW	3	53479064	missense	probably benign	0.04
R0616:Proser1	UTSW	3	53474697	missense	probably damaging	0.98
R0629:Proser1	UTSW	3	53479064	missense	probably benign	0.04
R0707:Proser1	UTSW	3	53478776	missense	probably damaging	1.00
R1568:Proser1	UTSW	3	53477759	missense	possibly damaging	0.54
R1997:Proser1	UTSW	3	53478871	missense	probably benign	0.10
R2129:Proser1	UTSW	3	53477945	missense	probably benign	0.20
R2207:Proser1	UTSW	3	53478391	missense	probably benign	0.00
R2851:Proser1	UTSW	3	53480545	missense	probably benign	0.07
R4077:Proser1	UTSW	3	53478541	missense	probably damaging	1.00
R4093:Proser1	UTSW	3	53479712	critical splice donor site	probably null
R4970:Proser1	UTSW	3	53464306	missense	probably damaging	1.00
R4988:Proser1	UTSW	3	53479625	missense	probably damaging	0.98
R5611:Proser1	UTSW	3	53478875	missense	probably benign	0.10
R6090:Proser1	UTSW	3	53478667	missense	probably benign	0.00
R6146:Proser1	UTSW	3	53478119	missense	probably damaging	1.00
R6459:Proser1	UTSW	3	53478329	missense	possibly damaging	0.51
R6880:Proser1	UTSW	3	53477839	missense	probably benign
R7308:Proser1	UTSW	3	53478704	missense	probably benign	0.40
R7456:Proser1	UTSW	3	53478518	missense	probably damaging	0.99
R7787:Proser1	UTSW	3	53473548	missense	probably damaging	1.00
R7903:Proser1	UTSW	3	53479082	nonsense	probably null
R8108:Proser1	UTSW	3	53472088	critical splice donor site	probably null
R8172:Proser1	UTSW	3	53478851	missense	possibly damaging	0.73
R8414:Proser1	UTSW	3	53478556	missense	probably damaging	1.00
R8677:Proser1	UTSW	3	53477701	missense	probably benign	0.01
R9064:Proser1	UTSW	3	53477506	missense	probably damaging	1.00
R9164:Proser1	UTSW	3	53472073	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGAATGAGTGCGACCAACACTG -3'
(R):5'- CGCAGCACTGGCAATTACAGAAGG -3'

Sequencing Primer
(F):5'- GTGTTCCCAACGCCTCAG -3'
(R):5'- CTGGCAATTACAGAAGGAGTCG -3'

Posted On

2013-07-11