Incidental Mutation 'R7586:Ganab'
ID587178
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Namealpha glucosidase 2 alpha neutral subunit
SynonymsG2an, GluII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R7586 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8898090-8916663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8911352 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 552 (Y552F)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096246
AA Change: Y552F

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: Y552F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,793 N446Y possibly damaging Het
Ankdd1a C T 9: 65,502,184 probably null Het
Ankrd31 A G 13: 96,832,054 E733G possibly damaging Het
Cars2 C T 8: 11,530,321 W239* probably null Het
Catsperz A T 19: 6,922,561 L192* probably null Het
Cdh3 T C 8: 106,511,343 probably null Het
Cfh C T 1: 140,147,721 V260M probably damaging Het
Clcn4 T A 7: 7,293,959 S227C probably benign Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Col27a1 C A 4: 63,225,041 A322D probably damaging Het
Egflam C T 15: 7,208,601 G934S probably damaging Het
Eloa A G 4: 136,007,199 V665A probably damaging Het
Epg5 A G 18: 78,030,060 T2433A probably benign Het
Ercc5 A G 1: 44,175,851 N848S possibly damaging Het
Fbrsl1 A C 5: 110,378,154 F61V probably damaging Het
Fry T C 5: 150,426,218 Y1595H probably damaging Het
Fstl4 A G 11: 53,072,429 N213D probably benign Het
Gab2 C T 7: 97,301,438 P446L probably damaging Het
Gfy C T 7: 45,177,538 R378Q probably damaging Het
Gm3285 T C 10: 77,862,041 V8A unknown Het
Gm8251 G A 1: 44,060,013 R642W probably benign Het
Grip1 A T 10: 120,077,138 probably null Het
Gtf3c3 A G 1: 54,403,593 L764P probably damaging Het
Igfbp2 A T 1: 72,849,148 M150L probably benign Het
Jakmip2 C T 18: 43,540,611 R796Q probably damaging Het
Jpt1 T A 11: 115,498,195 R141W probably damaging Het
Junb T C 8: 84,978,173 E86G probably damaging Het
Klhl41 A T 2: 69,674,724 D457V probably benign Het
Lama2 T C 10: 27,101,393 Y1930C probably benign Het
Med13 A T 11: 86,271,002 I2167N probably damaging Het
Msh3 A G 13: 92,349,332 probably benign Het
Myo1b A C 1: 51,778,324 I593S probably damaging Het
Myo1c A T 11: 75,657,519 T16S possibly damaging Het
Ndufaf4 C T 4: 24,901,829 L126F probably damaging Het
Nlrp9a A T 7: 26,557,296 N113I possibly damaging Het
Olfr1000 G C 2: 85,608,184 S242C probably damaging Het
Olfr1173 T A 2: 88,274,450 I200F probably damaging Het
Olfr478 T A 7: 108,031,921 T141S probably benign Het
Pabpc6 A T 17: 9,668,682 D313E probably damaging Het
Pcdhb2 G T 18: 37,295,804 G277* probably null Het
Phkb T G 8: 86,029,597 V840G probably damaging Het
Pip4k2c A G 10: 127,199,086 F415S probably damaging Het
Ptprb A G 10: 116,343,874 E1112G probably damaging Het
Pum2 A G 12: 8,747,206 D847G probably damaging Het
Qrich2 C T 11: 116,455,624 R1458H probably benign Het
Rdh11 T C 12: 79,185,183 Y199C probably damaging Het
Scamp3 A G 3: 89,180,366 Y171C probably damaging Het
Serpinb9b T C 13: 33,039,760 S312P probably damaging Het
Slain2 G A 5: 72,965,822 S461N probably benign Het
Slc23a1 G A 18: 35,625,838 T100I probably damaging Het
Spata31d1b T A 13: 59,718,380 I1114N probably damaging Het
Spinkl A G 18: 44,174,589 S2P probably damaging Het
Srrt T C 5: 137,302,195 N173S probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Supt16 A T 14: 52,173,556 V697E probably damaging Het
Taf6l C T 19: 8,783,846 E53K probably damaging Het
Tmem81 A T 1: 132,507,773 I106F probably damaging Het
Tnxb C A 17: 34,716,408 L2561I probably damaging Het
Top3b G A 16: 16,891,368 R640H probably benign Het
Trpm7 A T 2: 126,810,165 S1463T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tubal3 A C 13: 3,928,198 D38A possibly damaging Het
Vps13a T A 19: 16,647,598 I2766F probably benign Het
Wwc1 A T 11: 35,844,195 V951E possibly damaging Het
Zfp777 A T 6: 48,029,218 M414K probably benign Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8902595 missense probably benign
IGL00434:Ganab APN 19 8907343 missense probably damaging 1.00
IGL01415:Ganab APN 19 8914694 splice site probably benign
IGL02418:Ganab APN 19 8911069 missense probably null 0.97
IGL02886:Ganab APN 19 8911027 splice site probably benign
IGL02997:Ganab APN 19 8915412 missense probably benign 0.00
IGL03108:Ganab APN 19 8912476 missense probably damaging 1.00
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0349:Ganab UTSW 19 8911652 missense probably null 0.11
R0457:Ganab UTSW 19 8907250 missense possibly damaging 0.92
R0551:Ganab UTSW 19 8907280 missense probably benign 0.35
R0645:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0652:Ganab UTSW 19 8915402 critical splice acceptor site probably null
R0688:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0726:Ganab UTSW 19 8911113 missense probably damaging 1.00
R1427:Ganab UTSW 19 8915666 missense probably benign 0.00
R1946:Ganab UTSW 19 8910808 missense probably damaging 1.00
R1955:Ganab UTSW 19 8911616 nonsense probably null
R2173:Ganab UTSW 19 8902260 unclassified probably benign
R2280:Ganab UTSW 19 8909468 missense probably damaging 1.00
R2281:Ganab UTSW 19 8909468 missense probably damaging 1.00
R4897:Ganab UTSW 19 8914991 missense probably benign 0.07
R5224:Ganab UTSW 19 8910591 missense probably benign 0.35
R5269:Ganab UTSW 19 8911937 missense probably damaging 1.00
R5323:Ganab UTSW 19 8908685 missense probably benign 0.00
R5850:Ganab UTSW 19 8911707 missense probably damaging 1.00
R6469:Ganab UTSW 19 8902632 critical splice donor site probably null
R6911:Ganab UTSW 19 8907788 intron probably null
R7284:Ganab UTSW 19 8912540 missense probably damaging 1.00
R7412:Ganab UTSW 19 8912528 missense probably benign 0.01
R7413:Ganab UTSW 19 8904975 missense probably benign 0.01
R7466:Ganab UTSW 19 8914569 nonsense probably null
R7657:Ganab UTSW 19 8907357 missense probably damaging 0.99
R7671:Ganab UTSW 19 8912852 missense possibly damaging 0.94
R7729:Ganab UTSW 19 8914712 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GATGGCTCTGATTACGAGGG -3'
(R):5'- GACGGTCGACAGTAAACACTG -3'

Sequencing Primer
(F):5'- CAGGTAGGCAGGCCCATAATTG -3'
(R):5'- CACTGTCAGAAAGAAAGCTTCTAG -3'
Posted On2019-10-24