Incidental Mutation 'R7587:Pms1'
ID587181
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene NamePMS1 homolog 1, mismatch repair system component
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location53189187-53297018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53207316 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 355 (S355P)
Ref Sequence ENSEMBL: ENSMUSP00000027267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000135246]
Predicted Effect probably benign
Transcript: ENSMUST00000027267
AA Change: S355P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: S355P

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135246
AA Change: S355P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119632
Gene: ENSMUSG00000026098
AA Change: S355P

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53206556 splice site probably benign
IGL00937:Pms1 APN 1 53275251 missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53206971 missense probably benign
IGL02109:Pms1 APN 1 53207409 missense probably damaging 0.96
IGL02245:Pms1 APN 1 53207360 missense probably damaging 1.00
IGL02273:Pms1 APN 1 53207997 missense probably damaging 1.00
IGL02339:Pms1 APN 1 53275165 missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53195037 nonsense probably null
R0530:Pms1 UTSW 1 53196813 unclassified probably null
R1398:Pms1 UTSW 1 53207276 missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53206969 missense probably benign 0.02
R1831:Pms1 UTSW 1 53207211 missense probably benign 0.00
R1838:Pms1 UTSW 1 53192098 critical splice donor site probably null
R1867:Pms1 UTSW 1 53189387 missense probably benign 0.36
R1874:Pms1 UTSW 1 53207233 missense probably benign 0.16
R1939:Pms1 UTSW 1 53196976 missense probably damaging 1.00
R1991:Pms1 UTSW 1 53282042 missense probably damaging 1.00
R1993:Pms1 UTSW 1 53195015 missense probably benign
R1995:Pms1 UTSW 1 53195015 missense probably benign
R2049:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R2058:Pms1 UTSW 1 53275168 missense probably benign 0.00
R2140:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R4078:Pms1 UTSW 1 53267789 unclassified probably null
R4608:Pms1 UTSW 1 53194938 missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53189474 nonsense probably null
R5164:Pms1 UTSW 1 53207640 missense probably damaging 0.99
R5200:Pms1 UTSW 1 53206757 missense probably benign 0.00
R5397:Pms1 UTSW 1 53192120 nonsense probably null
R5745:Pms1 UTSW 1 53207702 nonsense probably null
R6440:Pms1 UTSW 1 53195021 missense probably damaging 0.98
R6445:Pms1 UTSW 1 53192194 missense possibly damaging 0.77
R6802:Pms1 UTSW 1 53206792 missense probably benign 0.06
R6975:Pms1 UTSW 1 53189431 missense probably damaging 0.99
R7020:Pms1 UTSW 1 53189382 missense probably damaging 1.00
R7037:Pms1 UTSW 1 53207611 missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53256730 missense probably benign 0.02
R7417:Pms1 UTSW 1 53197072 missense probably benign 0.00
R7716:Pms1 UTSW 1 53207608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGTGCTCCATAGAACCTAC -3'
(R):5'- AAACTTATGCTGTCCTAACTGTTCC -3'

Sequencing Primer
(F):5'- TGTGCTCCATAGAACCTACAGAATG -3'
(R):5'- CCTAACTGTTCCCTTATTAAAATGGC -3'
Posted On2019-10-24