Incidental Mutation 'R7587:Pms1'
ID587181
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene NamePMS1 homolog 1, mismatch repair system component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53189187-53297018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53207316 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 355 (S355P)
Ref Sequence ENSEMBL: ENSMUSP00000027267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000135246]
Predicted Effect probably benign
Transcript: ENSMUST00000027267
AA Change: S355P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: S355P

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135246
AA Change: S355P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119632
Gene: ENSMUSG00000026098
AA Change: S355P

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Kdm3b A G 18: 34,797,027 probably null Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lpp A T 16: 24,762,279 probably null Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Ncbp3 T C 11: 73,066,765 probably null Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53206556 splice site probably benign
IGL00937:Pms1 APN 1 53275251 missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53206971 missense probably benign
IGL02109:Pms1 APN 1 53207409 missense probably damaging 0.96
IGL02245:Pms1 APN 1 53207360 missense probably damaging 1.00
IGL02273:Pms1 APN 1 53207997 missense probably damaging 1.00
IGL02339:Pms1 APN 1 53275165 missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53195037 nonsense probably null
R0530:Pms1 UTSW 1 53196813 splice site probably null
R1398:Pms1 UTSW 1 53207276 missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53206969 missense probably benign 0.02
R1831:Pms1 UTSW 1 53207211 missense probably benign 0.00
R1838:Pms1 UTSW 1 53192098 critical splice donor site probably null
R1867:Pms1 UTSW 1 53189387 missense probably benign 0.36
R1874:Pms1 UTSW 1 53207233 missense probably benign 0.16
R1939:Pms1 UTSW 1 53196976 missense probably damaging 1.00
R1991:Pms1 UTSW 1 53282042 missense probably damaging 1.00
R1993:Pms1 UTSW 1 53195015 missense probably benign
R1995:Pms1 UTSW 1 53195015 missense probably benign
R2049:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R2058:Pms1 UTSW 1 53275168 missense probably benign 0.00
R2140:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R4078:Pms1 UTSW 1 53267789 splice site probably null
R4608:Pms1 UTSW 1 53194938 missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53189474 nonsense probably null
R5164:Pms1 UTSW 1 53207640 missense probably damaging 0.99
R5200:Pms1 UTSW 1 53206757 missense probably benign 0.00
R5397:Pms1 UTSW 1 53192120 nonsense probably null
R5745:Pms1 UTSW 1 53207702 nonsense probably null
R6440:Pms1 UTSW 1 53195021 missense probably damaging 0.98
R6445:Pms1 UTSW 1 53192194 missense possibly damaging 0.77
R6802:Pms1 UTSW 1 53206792 missense probably benign 0.06
R6975:Pms1 UTSW 1 53189431 missense probably damaging 0.99
R7020:Pms1 UTSW 1 53189382 missense probably damaging 1.00
R7037:Pms1 UTSW 1 53207611 missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53256730 missense probably benign 0.02
R7417:Pms1 UTSW 1 53197072 missense probably benign 0.00
R7716:Pms1 UTSW 1 53207608 missense probably damaging 1.00
R8178:Pms1 UTSW 1 53207346 missense probably benign 0.00
R8336:Pms1 UTSW 1 53206826 missense probably benign
R8399:Pms1 UTSW 1 53267932 critical splice acceptor site probably null
R8736:Pms1 UTSW 1 53267894 missense possibly damaging 0.63
R8738:Pms1 UTSW 1 53282036 missense possibly damaging 0.67
R8751:Pms1 UTSW 1 53192110 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATGTGCTCCATAGAACCTAC -3'
(R):5'- AAACTTATGCTGTCCTAACTGTTCC -3'

Sequencing Primer
(F):5'- TGTGCTCCATAGAACCTACAGAATG -3'
(R):5'- CCTAACTGTTCCCTTATTAAAATGGC -3'
Posted On2019-10-24