Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Cdh20'

587182

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

Accession Numbers

Genbank: NM_011800

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104768529-104995481 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104941279 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 165 (F165S)

Ref Sequence

ENSEMBL: ENSMUSP00000052078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062528]

AlphaFold

Q9Z0M3

Predicted Effect

probably damaging
Transcript: ENSMUST00000062528
AA Change: F165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: F165S

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
CA	82	163	1.01e-15	SMART
CA	187	272	1.35e-30	SMART
CA	296	388	1.98e-14	SMART
CA	411	492	1.61e-23	SMART
CA	515	602	3.9e-13	SMART
transmembrane domain	620	642	N/A	INTRINSIC
Pfam:Cadherin_C	645	793	2.6e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104953887	missense	probably benign	0.05
IGL00743:Cdh20	APN	1	104947428	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104934256	missense	probably benign
IGL01393:Cdh20	APN	1	104934244	missense	probably benign
IGL01396:Cdh20	APN	1	104947429	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104934107	missense	probably benign	0.05
IGL01612:Cdh20	APN	1	104994170	missense	probably benign	0.02
IGL01947:Cdh20	APN	1	104993924	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104941037	missense	probably damaging	1.00
IGL02226:Cdh20	APN	1	104954091	splice site	probably benign
IGL02318:Cdh20	APN	1	104954039	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104975039	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104947465	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104934098	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104941257	missense	probably damaging	1.00
3-1:Cdh20	UTSW	1	104947420	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104984748	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104984748	missense	probably damaging	0.99
IGL02991:Cdh20	UTSW	1	104934247	missense	probably benign
R0178:Cdh20	UTSW	1	104975051	missense	possibly damaging	0.82
R1114:Cdh20	UTSW	1	104979014	missense	probably damaging	0.96
R1401:Cdh20	UTSW	1	104947497	missense	possibly damaging	0.65
R1502:Cdh20	UTSW	1	104954030	missense	probably benign	0.06
R1764:Cdh20	UTSW	1	104934345	splice site	probably benign
R2198:Cdh20	UTSW	1	104947322	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104947414	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104975015	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104947474	missense	probably damaging	1.00
R4243:Cdh20	UTSW	1	104942143	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104942143	missense	probably damaging	1.00
R4349:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104934310	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104984685	missense	probably damaging	0.99
R4795:Cdh20	UTSW	1	104941264	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104941264	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104984803	missense	probably damaging	1.00
R5056:Cdh20	UTSW	1	104953997	missense	probably benign	0.00
R5127:Cdh20	UTSW	1	104947348	missense	probably damaging	1.00
R5269:Cdh20	UTSW	1	104934157	missense	possibly damaging	0.67
R5563:Cdh20	UTSW	1	104947357	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104975075	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104984910	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104934098	start codon destroyed	probably null	0.49
R5933:Cdh20	UTSW	1	104984671	missense	probably damaging	1.00
R6109:Cdh20	UTSW	1	104994014	missense	probably damaging	1.00
R6521:Cdh20	UTSW	1	104942134	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104984686	missense	possibly damaging	0.95
R7169:Cdh20	UTSW	1	104947353	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104993977	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104954071	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104970873	missense	probably benign
R7535:Cdh20	UTSW	1	104975043	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104941299	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	104947322	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104934173	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104984748	missense	probably damaging	0.99
R8257:Cdh20	UTSW	1	104994237	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104970858	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104934044	start gained	probably benign
R8870:Cdh20	UTSW	1	104945323	missense	probably damaging	0.99
R9310:Cdh20	UTSW	1	104947336	missense	probably damaging	1.00
R9542:Cdh20	UTSW	1	104947342	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104941098	missense	probably benign	0.07
R9664:Cdh20	UTSW	1	104934340	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GGAGCAGGCATCGTGTTTAC -3'
(R):5'- TTCTGATATCTCCATAGCTTCAGG -3'

Sequencing Primer
(F):5'- GTTTACCATTGATGACACCACTGGAG -3'
(R):5'- GGAAGCTACCTATTGAAGGAG -3'

Posted On

2019-10-24