Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Cdh20'

587182

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

045712-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104869004 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 165 (F165S)

Ref Sequence

ENSEMBL: ENSMUSP00000052078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062528]

AlphaFold

Q9Z0M3

Predicted Effect

probably damaging
Transcript: ENSMUST00000062528
AA Change: F165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: F165S

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
CA	82	163	1.01e-15	SMART
CA	187	272	1.35e-30	SMART
CA	296	388	1.98e-14	SMART
CA	411	492	1.61e-23	SMART
CA	515	602	3.9e-13	SMART
transmembrane domain	620	642	N/A	INTRINSIC
Pfam:Cadherin_C	645	793	2.6e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,585,736 (GRCm39)	T131A	probably damaging	Het
Asah1	A	T	8: 41,827,578 (GRCm39)	V15D	probably benign	Het
Asic1	A	C	15: 99,593,471 (GRCm39)	Q276P	probably damaging	Het
Atl2	A	T	17: 80,172,496 (GRCm39)	V158E	probably benign	Het
Atrn	T	A	2: 130,822,034 (GRCm39)	I909N	probably damaging	Het
BC034090	A	G	1: 155,093,232 (GRCm39)	V742A	probably damaging	Het
Capzb	T	A	4: 138,989,334 (GRCm39)	D85E	possibly damaging	Het
Cfap44	A	G	16: 44,224,469 (GRCm39)	E59G	probably benign	Het
Clpsl2	G	A	17: 28,768,515 (GRCm39)	V10I	probably benign	Het
D630003M21Rik	T	A	2: 158,042,976 (GRCm39)	S855C	probably damaging	Het
D630003M21Rik	T	C	2: 158,038,308 (GRCm39)	Y1046C	probably benign	Het
D6Wsu163e	A	G	6: 126,932,859 (GRCm39)	I361V	probably benign	Het
Dchs2	A	G	3: 83,211,822 (GRCm39)	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,460,069 (GRCm39)	K679Q	probably damaging	Het
Dio2	A	G	12: 90,696,334 (GRCm39)	V218A	probably benign	Het
Gpr107	A	T	2: 31,058,838 (GRCm39)	K109N	probably benign	Het
Gpr108	C	T	17: 57,543,732 (GRCm39)	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,681,288 (GRCm39)	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,512,065 (GRCm39)	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,930,080 (GRCm39)		probably null	Het
Lipc	A	G	9: 70,726,206 (GRCm39)	Y168H	probably damaging	Het
Lipi	C	T	16: 75,347,103 (GRCm39)	V439M	probably benign	Het
Lpp	A	T	16: 24,581,029 (GRCm39)		probably null	Het
Lrp1b	T	G	2: 40,620,729 (GRCm39)	D3583A		Het
Ltbr	T	C	6: 125,289,315 (GRCm39)	T165A	probably benign	Het
Mroh3	A	G	1: 136,118,736 (GRCm39)	I527T	probably benign	Het
Mylk	A	G	16: 34,742,887 (GRCm39)	E1133G	probably benign	Het
Nat3	T	C	8: 68,000,226 (GRCm39)	I35T	probably damaging	Het
Ncbp3	T	C	11: 72,957,591 (GRCm39)		probably null	Het
Nedd1	G	A	10: 92,534,592 (GRCm39)	T306M	probably benign	Het
Nexn	T	C	3: 151,952,815 (GRCm39)	R316G	probably benign	Het
Nox4	A	G	7: 86,966,510 (GRCm39)	H207R	probably damaging	Het
Nsun6	T	C	2: 15,044,636 (GRCm39)	Q110R	probably benign	Het
Or1e1b-ps1	C	T	11: 73,846,010 (GRCm39)	Q165*	probably null	Het
Or52n2c	C	T	7: 104,574,263 (GRCm39)	R236H	probably benign	Het
Or7g32	T	A	9: 19,408,818 (GRCm39)	V258E	probably damaging	Het
Pappa2	T	C	1: 158,678,701 (GRCm39)	D905G	probably damaging	Het
Pepd	T	C	7: 34,668,965 (GRCm39)	L195S	probably damaging	Het
Pms1	A	G	1: 53,246,475 (GRCm39)	S355P	probably benign	Het
Pop1	A	T	15: 34,502,559 (GRCm39)	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 94,892,766 (GRCm39)	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,845,777 (GRCm39)		probably null	Het
Pramel57	A	G	5: 95,669,270 (GRCm39)	T100A	probably damaging	Het
Prss35	T	A	9: 86,637,427 (GRCm39)	C66S	probably damaging	Het
Rfc3	A	T	5: 151,574,616 (GRCm39)	M1K	probably null	Het
Rffl	T	C	11: 82,700,974 (GRCm39)	D284G	probably damaging	Het
Robo3	T	C	9: 37,340,942 (GRCm39)	D110G	probably damaging	Het
Rtel1	G	A	2: 180,964,108 (GRCm39)	V36M	probably damaging	Het
Slc1a7	T	A	4: 107,867,683 (GRCm39)	I457K	possibly damaging	Het
Smco1	A	G	16: 32,092,541 (GRCm39)	M71V	probably benign	Het
Snrnp200	G	A	2: 127,069,822 (GRCm39)	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,305 (GRCm39)	I356F	probably damaging	Het
Stk24	C	T	14: 121,539,699 (GRCm39)	A166T	probably damaging	Het
Tada2b	T	C	5: 36,634,111 (GRCm39)	I156V	probably benign	Het
Tasor2	T	C	13: 3,618,849 (GRCm39)	K2251E	possibly damaging	Het
Tbce	C	T	13: 14,194,327 (GRCm39)	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,532,155 (GRCm39)	L92P	probably damaging	Het
Tnr	T	A	1: 159,713,778 (GRCm39)	D735E	probably benign	Het
Tram1	T	C	1: 13,649,771 (GRCm39)	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,376,118 (GRCm39)		probably null	Het
Unc5b	C	T	10: 60,618,899 (GRCm39)	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,681,153 (GRCm39)	T1041M	probably benign	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2068:Cdh20	UTSW	1	110,065,666 (GRCm39)	nonsense	probably null
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2198:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5196:Cdh20	UTSW	1	110,065,730 (GRCm39)	missense	probably damaging	0.99
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5496:Cdh20	UTSW	1	109,976,647 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7532:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8022:Cdh20	UTSW	1	109,988,838 (GRCm39)	missense	probably benign	0.02
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104,898,583 (GRCm39)	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCAGGCATCGTGTTTAC -3'
(R):5'- TTCTGATATCTCCATAGCTTCAGG -3'

Sequencing Primer
(F):5'- GTTTACCATTGATGACACCACTGGAG -3'
(R):5'- GGAAGCTACCTATTGAAGGAG -3'

Posted On

2019-10-24