Incidental Mutation 'R7587:BC034090'
ID 587184
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene Name cDNA sequence BC034090
Synonyms
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 155088217-155120190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155093232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 742 (V742A)
Ref Sequence ENSEMBL: ENSMUSP00000037456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035914] [ENSMUST00000186156]
AlphaFold A0A087WP46
Predicted Effect probably damaging
Transcript: ENSMUST00000035914
AA Change: V742A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037456
Gene: ENSMUSG00000033722
AA Change: V742A

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:DUF4685 44 168 6.6e-57 PFAM
low complexity region 486 500 N/A INTRINSIC
low complexity region 562 568 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
PDZ 830 905 4.8e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186156
AA Change: V1104A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: V1104A

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155,101,193 (GRCm39) missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155,101,197 (GRCm39) nonsense probably null
IGL00481:BC034090 APN 1 155,108,267 (GRCm39) missense probably benign 0.04
IGL01309:BC034090 APN 1 155,102,130 (GRCm39) missense probably damaging 0.98
IGL01813:BC034090 APN 1 155,102,085 (GRCm39) nonsense probably null
IGL01938:BC034090 APN 1 155,108,338 (GRCm39) splice site probably null
IGL01982:BC034090 APN 1 155,099,078 (GRCm39) missense probably damaging 1.00
IGL02115:BC034090 APN 1 155,108,397 (GRCm39) intron probably benign
IGL02338:BC034090 APN 1 155,093,217 (GRCm39) missense probably damaging 1.00
IGL02406:BC034090 APN 1 155,100,899 (GRCm39) missense probably benign 0.00
IGL03243:BC034090 APN 1 155,101,401 (GRCm39) missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155,101,856 (GRCm39) missense probably damaging 1.00
BB004:BC034090 UTSW 1 155,117,371 (GRCm39) nonsense probably null
BB014:BC034090 UTSW 1 155,117,371 (GRCm39) nonsense probably null
R0055:BC034090 UTSW 1 155,117,404 (GRCm39) missense probably damaging 1.00
R1436:BC034090 UTSW 1 155,101,662 (GRCm39) missense probably benign 0.04
R1649:BC034090 UTSW 1 155,101,319 (GRCm39) missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155,101,610 (GRCm39) missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155,101,575 (GRCm39) missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155,100,972 (GRCm39) missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155,097,340 (GRCm39) unclassified probably benign
R2012:BC034090 UTSW 1 155,097,178 (GRCm39) missense probably damaging 0.98
R2133:BC034090 UTSW 1 155,101,532 (GRCm39) missense probably benign 0.27
R3426:BC034090 UTSW 1 155,117,244 (GRCm39) missense probably benign 0.00
R3427:BC034090 UTSW 1 155,117,244 (GRCm39) missense probably benign 0.00
R3428:BC034090 UTSW 1 155,117,244 (GRCm39) missense probably benign 0.00
R3782:BC034090 UTSW 1 155,102,024 (GRCm39) missense probably damaging 1.00
R3792:BC034090 UTSW 1 155,117,543 (GRCm39) missense probably damaging 0.98
R4234:BC034090 UTSW 1 155,117,326 (GRCm39) missense probably benign
R4373:BC034090 UTSW 1 155,101,904 (GRCm39) missense probably benign 0.22
R4377:BC034090 UTSW 1 155,108,196 (GRCm39) missense probably benign 0.00
R4661:BC034090 UTSW 1 155,108,221 (GRCm39) missense probably damaging 0.98
R4676:BC034090 UTSW 1 155,102,010 (GRCm39) missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155,100,836 (GRCm39) missense probably damaging 1.00
R5170:BC034090 UTSW 1 155,089,396 (GRCm39) missense probably damaging 1.00
R5340:BC034090 UTSW 1 155,102,160 (GRCm39) missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155,101,349 (GRCm39) missense probably benign 0.09
R5384:BC034090 UTSW 1 155,117,773 (GRCm39) missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155,117,214 (GRCm39) missense probably benign 0.01
R5891:BC034090 UTSW 1 155,108,793 (GRCm39) unclassified probably benign
R6060:BC034090 UTSW 1 155,117,245 (GRCm39) missense probably benign 0.00
R6092:BC034090 UTSW 1 155,100,659 (GRCm39) missense probably damaging 0.99
R6662:BC034090 UTSW 1 155,102,085 (GRCm39) missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155,117,676 (GRCm39) missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155,097,131 (GRCm39) missense probably benign 0.03
R6970:BC034090 UTSW 1 155,117,185 (GRCm39) missense probably damaging 1.00
R7144:BC034090 UTSW 1 155,117,777 (GRCm39) missense probably damaging 1.00
R7201:BC034090 UTSW 1 155,117,680 (GRCm39) missense probably damaging 0.98
R7265:BC034090 UTSW 1 155,101,073 (GRCm39) missense probably damaging 0.96
R7380:BC034090 UTSW 1 155,108,229 (GRCm39) missense probably damaging 1.00
R7436:BC034090 UTSW 1 155,102,127 (GRCm39) missense probably damaging 1.00
R7569:BC034090 UTSW 1 155,093,151 (GRCm39) missense probably benign 0.00
R7664:BC034090 UTSW 1 155,117,377 (GRCm39) missense probably damaging 1.00
R7737:BC034090 UTSW 1 155,117,419 (GRCm39) missense possibly damaging 0.66
R7782:BC034090 UTSW 1 155,108,410 (GRCm39) intron probably benign
R7927:BC034090 UTSW 1 155,117,371 (GRCm39) nonsense probably null
R8079:BC034090 UTSW 1 155,101,032 (GRCm39) missense probably damaging 1.00
R8204:BC034090 UTSW 1 155,117,488 (GRCm39) missense probably damaging 1.00
R8558:BC034090 UTSW 1 155,097,085 (GRCm39) missense possibly damaging 0.95
R8832:BC034090 UTSW 1 155,102,034 (GRCm39) missense probably damaging 1.00
R8858:BC034090 UTSW 1 155,101,964 (GRCm39) missense probably benign 0.17
R8879:BC034090 UTSW 1 155,102,103 (GRCm39) missense probably benign
R9004:BC034090 UTSW 1 155,102,138 (GRCm39) missense possibly damaging 0.87
R9036:BC034090 UTSW 1 155,117,419 (GRCm39) missense possibly damaging 0.66
R9141:BC034090 UTSW 1 155,108,474 (GRCm39) intron probably benign
R9293:BC034090 UTSW 1 155,101,518 (GRCm39) missense probably benign 0.29
R9348:BC034090 UTSW 1 155,099,049 (GRCm39) missense probably benign 0.00
R9440:BC034090 UTSW 1 155,101,961 (GRCm39) missense probably benign 0.06
R9477:BC034090 UTSW 1 155,102,087 (GRCm39) missense probably damaging 1.00
R9608:BC034090 UTSW 1 155,099,135 (GRCm39) missense possibly damaging 0.79
R9700:BC034090 UTSW 1 155,101,982 (GRCm39) missense probably damaging 1.00
R9787:BC034090 UTSW 1 155,117,955 (GRCm39) missense possibly damaging 0.95
X0002:BC034090 UTSW 1 155,102,025 (GRCm39) nonsense probably null
Z1187:BC034090 UTSW 1 155,117,245 (GRCm39) missense probably benign 0.00
Z1189:BC034090 UTSW 1 155,117,245 (GRCm39) missense probably benign 0.00
Z1190:BC034090 UTSW 1 155,117,245 (GRCm39) missense probably benign 0.00
Z1192:BC034090 UTSW 1 155,117,245 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCCATTGCTCAACCAAAGC -3'
(R):5'- AGCTCATTTTGCTGGCTGAG -3'

Sequencing Primer
(F):5'- TTGCTCAACCAAAGCCCCAAAG -3'
(R):5'- TCCTGTCAGAAAGGTTCCTACATCAG -3'
Posted On 2019-10-24