Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Tnr'

587186

Institutional Source

Beutler Lab

Gene Symbol

Tnr

Ensembl Gene

ENSMUSG00000015829

Gene Name

tenascin R

Synonyms

TN-R, janusin, restrictin, J1-tenascin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

159523769-159931729 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 159886208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 735 (D735E)

Ref Sequence

ENSEMBL: ENSMUSP00000141553 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069]

AlphaFold

Q8BYI9

Predicted Effect

probably benign
Transcript: ENSMUST00000111669
AA Change: D735E

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: D735E

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192069
AA Change: D735E

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: D735E

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Tnr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Tnr	APN	1	159861245	missense	probably benign	0.00
IGL00905:Tnr	APN	1	159852182	missense	probably benign	0.06
IGL01396:Tnr	APN	1	159897024	missense	possibly damaging	0.91
IGL01550:Tnr	APN	1	159874258	missense	probably benign
IGL01803:Tnr	APN	1	159868243	missense	probably damaging	1.00
IGL01845:Tnr	APN	1	159868006	unclassified	probably benign
IGL01983:Tnr	APN	1	159863779	missense	probably benign	0.00
IGL01985:Tnr	APN	1	159919037	missense	possibly damaging	0.70
IGL02210:Tnr	APN	1	159852101	missense	probably benign	0.44
IGL02486:Tnr	APN	1	159852094	splice site	probably null
IGL03210:Tnr	APN	1	159888310	missense	probably benign	0.00
Assiduous	UTSW	1	159892023	missense	probably benign
Grip	UTSW	1	159886110	missense	possibly damaging	0.68
Persistent	UTSW	1	159852286	missense	probably benign
Tenacious	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0009:Tnr	UTSW	1	159852416	missense	probably damaging	1.00
R0042:Tnr	UTSW	1	159887025	missense	probably benign	0.01
R0594:Tnr	UTSW	1	159850335	missense	probably benign
R0617:Tnr	UTSW	1	159868103	missense	probably damaging	1.00
R0637:Tnr	UTSW	1	159850335	missense	possibly damaging	0.60
R0682:Tnr	UTSW	1	159852307	nonsense	probably null
R1171:Tnr	UTSW	1	159858210	missense	probably damaging	0.97
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1335:Tnr	UTSW	1	159868030	missense	probably benign	0.18
R1540:Tnr	UTSW	1	159850105	missense	probably damaging	0.99
R1697:Tnr	UTSW	1	159852030	missense	probably benign	0.00
R1938:Tnr	UTSW	1	159895037	nonsense	probably null
R1941:Tnr	UTSW	1	159850134	missense	possibly damaging	0.92
R2021:Tnr	UTSW	1	159852022	missense	probably benign
R2022:Tnr	UTSW	1	159852022	missense	probably benign
R2051:Tnr	UTSW	1	159892033	missense	probably benign
R2157:Tnr	UTSW	1	159858270	missense	probably damaging	0.98
R2319:Tnr	UTSW	1	159850048	start codon destroyed	probably null	1.00
R2936:Tnr	UTSW	1	159888362	missense	probably damaging	0.96
R3015:Tnr	UTSW	1	159888259	missense	probably benign	0.00
R3417:Tnr	UTSW	1	159895042	missense	probably benign	0.00
R3739:Tnr	UTSW	1	159923413	missense	possibly damaging	0.78
R3977:Tnr	UTSW	1	159892023	missense	probably benign
R4232:Tnr	UTSW	1	159886215	missense	possibly damaging	0.55
R4478:Tnr	UTSW	1	159884756	splice site	probably null
R4774:Tnr	UTSW	1	159897066	missense	probably damaging	1.00
R4829:Tnr	UTSW	1	159858404	missense	probably benign	0.24
R4837:Tnr	UTSW	1	159684788	intron	probably benign
R5111:Tnr	UTSW	1	159886228	missense	probably benign	0.04
R5224:Tnr	UTSW	1	159923315	missense	probably damaging	1.00
R5249:Tnr	UTSW	1	159684656	intron	probably benign
R5730:Tnr	UTSW	1	159888322	missense	probably benign	0.02
R5807:Tnr	UTSW	1	159886930	missense	possibly damaging	0.95
R5832:Tnr	UTSW	1	159886122	missense	probably benign	0.15
R5927:Tnr	UTSW	1	159912766	missense	probably damaging	1.00
R6049:Tnr	UTSW	1	159912754	missense	probably damaging	1.00
R6056:Tnr	UTSW	1	159886909	missense	probably damaging	0.99
R6063:Tnr	UTSW	1	159912684	missense	probably benign	0.00
R6141:Tnr	UTSW	1	159887122	missense	probably benign
R6218:Tnr	UTSW	1	159888314	missense	possibly damaging	0.94
R6275:Tnr	UTSW	1	159861270	missense	probably damaging	0.99
R6543:Tnr	UTSW	1	159924107	missense	probably damaging	1.00
R6626:Tnr	UTSW	1	159850252	missense	probably damaging	1.00
R7378:Tnr	UTSW	1	159884862	critical splice donor site	probably null
R7766:Tnr	UTSW	1	159888310	missense	probably benign	0.00
R8140:Tnr	UTSW	1	159863695	missense	probably damaging	0.99
R8215:Tnr	UTSW	1	159888290	missense	possibly damaging	0.91
R8248:Tnr	UTSW	1	159892093	missense	probably damaging	0.98
R8374:Tnr	UTSW	1	159858383	missense	probably benign	0.24
R8427:Tnr	UTSW	1	159886231	missense	possibly damaging	0.67
R8465:Tnr	UTSW	1	159886075	missense	probably benign	0.01
R8534:Tnr	UTSW	1	159919015	missense	probably benign	0.18
R8753:Tnr	UTSW	1	159850366	missense	probably benign	0.28
R8804:Tnr	UTSW	1	159858312	missense	probably benign
R8857:Tnr	UTSW	1	159886158	missense	probably benign	0.10
R8917:Tnr	UTSW	1	159874122	nonsense	probably null
R8930:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8932:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8940:Tnr	UTSW	1	159858297	missense	probably damaging	1.00
R9096:Tnr	UTSW	1	159850234	missense	probably benign	0.10
R9127:Tnr	UTSW	1	159886110	missense	possibly damaging	0.68
R9205:Tnr	UTSW	1	159895047	missense	probably benign
R9311:Tnr	UTSW	1	159850093	missense	probably benign	0.30
R9679:Tnr	UTSW	1	159892038	missense	probably benign	0.08
X0011:Tnr	UTSW	1	159889338	missense	probably benign	0.02
X0028:Tnr	UTSW	1	159874114	missense	probably damaging	1.00
Z1088:Tnr	UTSW	1	159895095	missense	probably benign	0.29
Z1177:Tnr	UTSW	1	159852091	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCAGTGTGAAATAGGCCAATTG -3'
(R):5'- GACTGGGACATCTGAATCACC -3'

Sequencing Primer
(F):5'- GCCTGTAATCTCACACTTAGGAGG -3'
(R):5'- TGGGACATCTGAATCACCTCATG -3'

Posted On

2019-10-24