Incidental Mutation 'R0622:F3'
ID58719
Institutional Source Beutler Lab
Gene Symbol F3
Ensembl Gene ENSMUSG00000028128
Gene Namecoagulation factor III
SynonymsTF, Cf3, tissue factor, Cf-3, CD142
MMRRC Submission 038811-MU
Accession Numbers

Genbank: NM_010171

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0622 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121723537-121735048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121725019 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 44 (D44V)
Ref Sequence ENSEMBL: ENSMUSP00000029771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029771]
Predicted Effect probably damaging
Transcript: ENSMUST00000029771
AA Change: D44V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029771
Gene: ENSMUSG00000028128
AA Change: D44V

DomainStartEndE-ValueType
Pfam:Tissue_fac 12 110 1.1e-26 PFAM
Pfam:Interfer-bind 138 245 5.1e-26 PFAM
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197731
Predicted Effect probably benign
Transcript: ENSMUST00000199997
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired blood vessel development, retarded growth, and, in most cases, midgestational lethality. On a mixed background, some mutants survive to birth and appear to be normal. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Targeted, other(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in F3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:F3 APN 3 121731674 missense possibly damaging 0.83
G5030:F3 UTSW 3 121724999 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R1367:F3 UTSW 3 121729374 missense probably damaging 0.98
R1371:F3 UTSW 3 121732510 missense probably damaging 1.00
R1925:F3 UTSW 3 121729383 missense probably damaging 1.00
R2100:F3 UTSW 3 121732433 missense possibly damaging 0.61
R2366:F3 UTSW 3 121732545 splice site probably null
R2471:F3 UTSW 3 121725040 missense probably damaging 1.00
R4577:F3 UTSW 3 121734114 missense probably benign 0.02
R5752:F3 UTSW 3 121732404 missense probably damaging 1.00
R6440:F3 UTSW 3 121725037 missense probably damaging 1.00
R6713:F3 UTSW 3 121731674 missense possibly damaging 0.83
R6845:F3 UTSW 3 121732475 missense probably benign 0.02
R6867:F3 UTSW 3 121729371 missense possibly damaging 0.93
R7145:F3 UTSW 3 121731586 missense probably damaging 1.00
R7511:F3 UTSW 3 121731557 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACTGGCAACAAAACATGTGCTC -3'
(R):5'- GCTTGGTAAGCACTCAAGGGACAG -3'

Sequencing Primer
(F):5'- AAACATGTGCTCCCTTTGATGG -3'
(R):5'- TTGATGGAACATCACAGTAGCC -3'
Posted On2013-07-11