Incidental Mutation 'R7587:Snrnp200'
ID 587190
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Name small nuclear ribonucleoprotein 200 (U5)
Synonyms Ascc3l1, A330064G03Rik, HELIC2, U5-200KD
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127050306-127082371 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 127069822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 989 (S989N)
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103220]
AlphaFold Q6P4T2
Predicted Effect probably damaging
Transcript: ENSMUST00000103220
AA Change: S989N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660
AA Change: S989N

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127,072,055 (GRCm39) missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127,074,392 (GRCm39) missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127,056,832 (GRCm39) splice site probably benign
IGL01319:Snrnp200 APN 2 127,072,047 (GRCm39) splice site probably benign
IGL01597:Snrnp200 APN 2 127,080,652 (GRCm39) unclassified probably benign
IGL01631:Snrnp200 APN 2 127,080,744 (GRCm39) unclassified probably benign
IGL01646:Snrnp200 APN 2 127,064,148 (GRCm39) missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127,074,825 (GRCm39) missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127,079,403 (GRCm39) missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127,071,911 (GRCm39) missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127,071,815 (GRCm39) missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127,058,030 (GRCm39) missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127,059,408 (GRCm39) missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127,060,346 (GRCm39) missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127,058,676 (GRCm39) splice site probably benign
IGL03108:Snrnp200 APN 2 127,080,087 (GRCm39) missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127,071,962 (GRCm39) critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127,075,233 (GRCm39) missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127,070,469 (GRCm39) missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127,070,469 (GRCm39) missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127,079,983 (GRCm39) missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127,079,983 (GRCm39) missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127,076,874 (GRCm39) splice site probably benign
R0047:Snrnp200 UTSW 2 127,076,874 (GRCm39) splice site probably benign
R0057:Snrnp200 UTSW 2 127,079,827 (GRCm39) missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127,074,902 (GRCm39) missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127,063,734 (GRCm39) missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127,068,065 (GRCm39) splice site probably benign
R1175:Snrnp200 UTSW 2 127,070,997 (GRCm39) missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127,078,737 (GRCm39) missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127,060,331 (GRCm39) missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127,070,158 (GRCm39) splice site probably benign
R1757:Snrnp200 UTSW 2 127,074,363 (GRCm39) missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127,058,656 (GRCm39) missense probably benign
R1808:Snrnp200 UTSW 2 127,060,948 (GRCm39) critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127,060,947 (GRCm39) critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127,058,095 (GRCm39) missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127,068,968 (GRCm39) missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127,076,904 (GRCm39) missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127,079,803 (GRCm39) missense probably benign 0.00
R2070:Snrnp200 UTSW 2 127,054,323 (GRCm39) missense possibly damaging 0.89
R2892:Snrnp200 UTSW 2 127,073,697 (GRCm39) missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127,063,802 (GRCm39) missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127,075,019 (GRCm39) splice site probably benign
R4028:Snrnp200 UTSW 2 127,079,486 (GRCm39) missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127,069,936 (GRCm39) missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127,064,137 (GRCm39) missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127,080,673 (GRCm39) missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127,071,022 (GRCm39) missense probably benign
R4575:Snrnp200 UTSW 2 127,076,986 (GRCm39) missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127,068,053 (GRCm39) missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127,069,798 (GRCm39) missense possibly damaging 0.89
R4728:Snrnp200 UTSW 2 127,059,334 (GRCm39) missense probably damaging 1.00
R4729:Snrnp200 UTSW 2 127,074,857 (GRCm39) missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127,053,527 (GRCm39) missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127,068,290 (GRCm39) nonsense probably null
R5213:Snrnp200 UTSW 2 127,073,661 (GRCm39) missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127,073,607 (GRCm39) missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127,074,986 (GRCm39) missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127,067,933 (GRCm39) missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127,068,007 (GRCm39) missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127,067,055 (GRCm39) missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127,052,655 (GRCm39) missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127,060,343 (GRCm39) missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127,060,343 (GRCm39) missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127,064,081 (GRCm39) nonsense probably null
R6434:Snrnp200 UTSW 2 127,080,574 (GRCm39) missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127,063,747 (GRCm39) missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127,068,372 (GRCm39) missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127,071,085 (GRCm39) missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127,059,192 (GRCm39) missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127,063,746 (GRCm39) missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127,068,404 (GRCm39) critical splice donor site probably null
R7672:Snrnp200 UTSW 2 127,063,822 (GRCm39) missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127,071,022 (GRCm39) missense probably benign
R7841:Snrnp200 UTSW 2 127,078,754 (GRCm39) missense probably benign 0.23
R7863:Snrnp200 UTSW 2 127,073,609 (GRCm39) missense probably damaging 1.00
R7916:Snrnp200 UTSW 2 127,074,979 (GRCm39) missense possibly damaging 0.51
R8117:Snrnp200 UTSW 2 127,071,051 (GRCm39) missense probably benign
R8262:Snrnp200 UTSW 2 127,068,928 (GRCm39) missense probably damaging 1.00
R8551:Snrnp200 UTSW 2 127,068,971 (GRCm39) missense probably benign 0.03
R8675:Snrnp200 UTSW 2 127,074,443 (GRCm39) missense possibly damaging 0.94
R8754:Snrnp200 UTSW 2 127,068,005 (GRCm39) missense probably damaging 1.00
R8852:Snrnp200 UTSW 2 127,060,349 (GRCm39) missense probably damaging 0.99
R8899:Snrnp200 UTSW 2 127,078,517 (GRCm39) missense probably damaging 1.00
R8937:Snrnp200 UTSW 2 127,068,902 (GRCm39) missense probably benign 0.04
R9030:Snrnp200 UTSW 2 127,053,466 (GRCm39) intron probably benign
R9260:Snrnp200 UTSW 2 127,078,428 (GRCm39) missense probably damaging 1.00
R9366:Snrnp200 UTSW 2 127,058,010 (GRCm39) missense probably benign 0.01
R9385:Snrnp200 UTSW 2 127,079,978 (GRCm39) critical splice acceptor site probably null
R9478:Snrnp200 UTSW 2 127,076,993 (GRCm39) critical splice donor site probably null
R9652:Snrnp200 UTSW 2 127,067,959 (GRCm39) missense probably damaging 1.00
R9653:Snrnp200 UTSW 2 127,067,959 (GRCm39) missense probably damaging 1.00
R9733:Snrnp200 UTSW 2 127,068,240 (GRCm39) missense probably damaging 1.00
RF016:Snrnp200 UTSW 2 127,072,476 (GRCm39) missense probably damaging 1.00
Z1176:Snrnp200 UTSW 2 127,076,895 (GRCm39) missense probably benign 0.10
Z1177:Snrnp200 UTSW 2 127,077,951 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATAGTATCACTTCTGCATTGGTCAG -3'
(R):5'- AGGTCTTAGAAAATCCACAGGGC -3'

Sequencing Primer
(F):5'- GCATTGGTCAGTTTGTTGTATCATC -3'
(R):5'- CTTAGAAAATCCACAGGGCAAGGATG -3'
Posted On 2019-10-24