Incidental Mutation 'R7587:D630003M21Rik'
ID 587192
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene Name RIKEN cDNA D630003M21 gene
Synonyms
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 158024453-158071142 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 158038308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1046 (Y1046C)
Ref Sequence ENSEMBL: ENSMUSP00000130623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046944
AA Change: Y1046C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: Y1046C

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103121
AA Change: Y1046C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: Y1046C

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109506
Predicted Effect probably benign
Transcript: ENSMUST00000169335
AA Change: Y1046C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: Y1046C

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158,055,332 (GRCm39) missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158,059,276 (GRCm39) missense probably benign
IGL01501:D630003M21Rik APN 2 158,042,987 (GRCm39) missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158,046,644 (GRCm39) missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158,045,130 (GRCm39) missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158,052,091 (GRCm39) missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158,059,408 (GRCm39) missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158,058,730 (GRCm39) missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158,042,918 (GRCm39) missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158,059,205 (GRCm39) missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158,058,664 (GRCm39) missense probably benign
IGL03148:D630003M21Rik APN 2 158,059,144 (GRCm39) missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158,038,308 (GRCm39) missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158,059,568 (GRCm39) missense probably benign
F5770:D630003M21Rik UTSW 2 158,042,931 (GRCm39) missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158,038,495 (GRCm39) missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158,044,987 (GRCm39) splice site probably benign
R0513:D630003M21Rik UTSW 2 158,042,228 (GRCm39) missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158,037,327 (GRCm39) intron probably benign
R1594:D630003M21Rik UTSW 2 158,053,550 (GRCm39) missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158,062,390 (GRCm39) missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158,059,477 (GRCm39) missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158,045,105 (GRCm39) missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158,050,341 (GRCm39) missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158,057,769 (GRCm39) missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158,046,631 (GRCm39) missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158,042,931 (GRCm39) missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158,037,392 (GRCm39) intron probably benign
R3937:D630003M21Rik UTSW 2 158,042,280 (GRCm39) missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158,038,513 (GRCm39) missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158,055,382 (GRCm39) missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158,055,382 (GRCm39) missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158,046,722 (GRCm39) missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158,046,722 (GRCm39) missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158,058,623 (GRCm39) missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158,038,059 (GRCm39) missense probably benign
R4947:D630003M21Rik UTSW 2 158,028,116 (GRCm39) missense unknown
R5005:D630003M21Rik UTSW 2 158,053,563 (GRCm39) missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158,059,553 (GRCm39) missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158,047,665 (GRCm39) missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158,042,955 (GRCm39) missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158,058,941 (GRCm39) missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158,058,941 (GRCm39) missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158,062,431 (GRCm39) missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158,062,312 (GRCm39) splice site probably null
R5770:D630003M21Rik UTSW 2 158,037,500 (GRCm39) intron probably benign
R5789:D630003M21Rik UTSW 2 158,058,734 (GRCm39) missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158,038,413 (GRCm39) missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158,046,577 (GRCm39) splice site probably null
R5969:D630003M21Rik UTSW 2 158,059,628 (GRCm39) missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158,059,504 (GRCm39) missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158,055,368 (GRCm39) missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158,059,321 (GRCm39) missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158,057,871 (GRCm39) missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158,062,415 (GRCm39) missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158,047,619 (GRCm39) critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158,062,436 (GRCm39) missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158,046,694 (GRCm39) missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158,042,228 (GRCm39) missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158,058,670 (GRCm39) missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158,057,932 (GRCm39) critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158,059,129 (GRCm39) missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158,042,144 (GRCm39) missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158,059,273 (GRCm39) missense probably damaging 1.00
R7587:D630003M21Rik UTSW 2 158,042,976 (GRCm39) missense probably damaging 1.00
R7713:D630003M21Rik UTSW 2 158,058,698 (GRCm39) nonsense probably null
R7792:D630003M21Rik UTSW 2 158,052,082 (GRCm39) missense possibly damaging 0.94
R7819:D630003M21Rik UTSW 2 158,058,718 (GRCm39) missense probably damaging 0.97
R7832:D630003M21Rik UTSW 2 158,059,588 (GRCm39) missense probably damaging 1.00
R8115:D630003M21Rik UTSW 2 158,058,510 (GRCm39) missense probably benign 0.23
R8482:D630003M21Rik UTSW 2 158,058,852 (GRCm39) missense probably benign 0.01
R8829:D630003M21Rik UTSW 2 158,058,856 (GRCm39) missense probably damaging 0.98
R8928:D630003M21Rik UTSW 2 158,059,447 (GRCm39) missense probably damaging 1.00
R9183:D630003M21Rik UTSW 2 158,059,112 (GRCm39) missense probably benign 0.00
R9254:D630003M21Rik UTSW 2 158,042,883 (GRCm39) missense probably damaging 1.00
R9661:D630003M21Rik UTSW 2 158,047,673 (GRCm39) missense possibly damaging 0.72
V7580:D630003M21Rik UTSW 2 158,042,931 (GRCm39) missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158,042,931 (GRCm39) missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158,042,931 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGTCCCTTCTGAGGAAAAGC -3'
(R):5'- ACTCCACTGCTACCTGAAGC -3'

Sequencing Primer
(F):5'- GAAAAGCTTCCCCCAGTTGG -3'
(R):5'- ACTGCTACCTGAAGCGCCTG -3'
Posted On 2019-10-24