Incidental Mutation 'R7587:Dchs2'
ID 587195
Institutional Source Beutler Lab
Gene Symbol Dchs2
Ensembl Gene ENSMUSG00000102692
Gene Name dachsous cadherin related 2
Synonyms LOC229459
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.384) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 83035255-83264516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83211822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1874 (I1874V)
Ref Sequence ENSEMBL: ENSMUSP00000141425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191829]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000191829
AA Change: I1874V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141425
Gene: ENSMUSG00000102692
AA Change: I1874V

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CA 70 149 1.6e-8 SMART
CA 173 278 1.9e-9 SMART
CA 302 395 2e-33 SMART
CA 423 522 3.2e-7 SMART
CA 546 642 1.1e-29 SMART
CA 666 750 5.6e-22 SMART
CA 774 855 1.5e-8 SMART
CA 876 958 4.2e-19 SMART
CA 982 1060 3e-8 SMART
CA 1067 1168 9.3e-7 SMART
CA 1192 1271 1.1e-28 SMART
CA 1299 1379 4e-16 SMART
CA 1403 1486 6.1e-16 SMART
CA 1510 1596 3.5e-18 SMART
CA 1619 1700 4.4e-27 SMART
CA 1724 1805 6.4e-27 SMART
CA 1828 1909 4.3e-29 SMART
CA 1933 2014 3.4e-27 SMART
CA 2038 2116 4.2e-7 SMART
CA 2139 2218 2.5e-15 SMART
CA 2242 2323 2.1e-34 SMART
CA 2346 2423 3e-24 SMART
CA 2447 2525 2e-17 SMART
CA 2549 2641 9.8e-16 SMART
CA 2665 2745 2.3e-24 SMART
CA 2769 2856 5.9e-19 SMART
CA 2880 2959 1e-3 SMART
transmembrane domain 2973 2995 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Dchs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1707:Dchs2 UTSW 3 83,034,912 (GRCm39) unclassified probably benign
R5857:Dchs2 UTSW 3 83,177,620 (GRCm39) missense possibly damaging 0.79
R5897:Dchs2 UTSW 3 83,192,717 (GRCm39) missense possibly damaging 0.95
R5959:Dchs2 UTSW 3 83,232,725 (GRCm39) missense probably benign 0.01
R6007:Dchs2 UTSW 3 83,253,534 (GRCm39) missense probably damaging 0.99
R6054:Dchs2 UTSW 3 83,253,543 (GRCm39) missense probably benign 0.00
R6059:Dchs2 UTSW 3 83,263,043 (GRCm39) missense probably benign 0.06
R6075:Dchs2 UTSW 3 83,262,368 (GRCm39) missense possibly damaging 0.68
R6379:Dchs2 UTSW 3 83,262,453 (GRCm39) missense probably damaging 1.00
R6393:Dchs2 UTSW 3 83,037,218 (GRCm39) missense probably damaging 1.00
R6405:Dchs2 UTSW 3 83,261,570 (GRCm39) missense probably benign 0.01
R6432:Dchs2 UTSW 3 83,178,425 (GRCm39) missense possibly damaging 0.96
R6434:Dchs2 UTSW 3 83,176,577 (GRCm39) missense probably damaging 1.00
R6561:Dchs2 UTSW 3 83,036,476 (GRCm39) missense probably benign 0.04
R6798:Dchs2 UTSW 3 83,255,593 (GRCm39) missense probably damaging 1.00
R6801:Dchs2 UTSW 3 83,035,841 (GRCm39) missense probably benign 0.00
R6855:Dchs2 UTSW 3 83,255,501 (GRCm39) missense probably benign 0.08
R6956:Dchs2 UTSW 3 83,261,233 (GRCm39) missense probably benign 0.00
R7090:Dchs2 UTSW 3 83,255,581 (GRCm39) missense probably benign 0.03
R7249:Dchs2 UTSW 3 83,035,336 (GRCm39) nonsense probably null
R7252:Dchs2 UTSW 3 83,232,610 (GRCm39) missense probably benign 0.04
R7462:Dchs2 UTSW 3 83,253,462 (GRCm39) splice site probably null
R7482:Dchs2 UTSW 3 83,156,032 (GRCm39) missense possibly damaging 0.68
R7487:Dchs2 UTSW 3 83,263,613 (GRCm39) missense probably damaging 0.99
R7529:Dchs2 UTSW 3 83,261,705 (GRCm39) missense possibly damaging 0.89
R7542:Dchs2 UTSW 3 83,176,591 (GRCm39) missense probably benign 0.16
R7544:Dchs2 UTSW 3 83,262,434 (GRCm39) missense probably damaging 1.00
R7547:Dchs2 UTSW 3 83,263,434 (GRCm39) missense probably damaging 0.96
R7632:Dchs2 UTSW 3 83,255,357 (GRCm39) missense probably benign 0.00
R7694:Dchs2 UTSW 3 83,036,789 (GRCm39) missense probably damaging 1.00
R7701:Dchs2 UTSW 3 83,253,513 (GRCm39) missense possibly damaging 0.83
R7746:Dchs2 UTSW 3 83,035,364 (GRCm39) missense possibly damaging 0.94
R7838:Dchs2 UTSW 3 83,211,834 (GRCm39) missense probably benign 0.01
R7886:Dchs2 UTSW 3 83,212,392 (GRCm39) missense probably damaging 1.00
R8055:Dchs2 UTSW 3 83,037,032 (GRCm39) missense probably benign 0.00
R8068:Dchs2 UTSW 3 83,207,745 (GRCm39) missense probably benign 0.12
R8094:Dchs2 UTSW 3 83,262,929 (GRCm39) missense probably benign 0.02
R8160:Dchs2 UTSW 3 83,178,112 (GRCm39) missense probably benign 0.19
R8166:Dchs2 UTSW 3 83,261,640 (GRCm39) missense probably benign 0.28
R8278:Dchs2 UTSW 3 83,178,310 (GRCm39) missense probably damaging 1.00
R8422:Dchs2 UTSW 3 83,232,570 (GRCm39) missense probably benign 0.30
R8506:Dchs2 UTSW 3 83,208,481 (GRCm39) missense probably benign 0.17
R8517:Dchs2 UTSW 3 83,178,419 (GRCm39) missense probably damaging 0.96
R8528:Dchs2 UTSW 3 83,261,918 (GRCm39) missense probably damaging 0.96
R8693:Dchs2 UTSW 3 83,192,631 (GRCm39) missense probably damaging 1.00
R8708:Dchs2 UTSW 3 83,036,049 (GRCm39) missense probably benign 0.00
R8757:Dchs2 UTSW 3 83,261,567 (GRCm39) missense possibly damaging 0.96
R8768:Dchs2 UTSW 3 83,253,592 (GRCm39) missense probably benign 0.12
R8776:Dchs2 UTSW 3 83,263,701 (GRCm39) missense possibly damaging 0.46
R8776-TAIL:Dchs2 UTSW 3 83,263,701 (GRCm39) missense possibly damaging 0.46
R8802:Dchs2 UTSW 3 83,253,544 (GRCm39) missense probably benign 0.01
R8821:Dchs2 UTSW 3 83,192,670 (GRCm39) missense probably benign 0.00
R8831:Dchs2 UTSW 3 83,192,670 (GRCm39) missense probably benign 0.00
R8897:Dchs2 UTSW 3 83,036,720 (GRCm39) missense probably damaging 1.00
R8957:Dchs2 UTSW 3 83,189,573 (GRCm39) missense
R8973:Dchs2 UTSW 3 83,261,763 (GRCm39) missense possibly damaging 0.86
R8991:Dchs2 UTSW 3 83,036,143 (GRCm39) missense probably benign 0.00
R9015:Dchs2 UTSW 3 83,188,751 (GRCm39) missense possibly damaging 0.86
R9051:Dchs2 UTSW 3 83,261,493 (GRCm39) missense probably benign 0.02
R9117:Dchs2 UTSW 3 83,176,662 (GRCm39) missense probably benign 0.31
R9120:Dchs2 UTSW 3 83,187,535 (GRCm39) missense probably damaging 0.99
R9189:Dchs2 UTSW 3 83,255,561 (GRCm39) missense probably damaging 1.00
R9264:Dchs2 UTSW 3 83,177,784 (GRCm39) missense probably damaging 1.00
R9280:Dchs2 UTSW 3 83,189,255 (GRCm39) missense possibly damaging 0.88
R9293:Dchs2 UTSW 3 83,189,361 (GRCm39) missense possibly damaging 0.90
R9322:Dchs2 UTSW 3 83,189,001 (GRCm39) missense possibly damaging 0.73
R9345:Dchs2 UTSW 3 83,036,101 (GRCm39) missense probably benign 0.00
R9408:Dchs2 UTSW 3 83,192,573 (GRCm39) missense probably benign 0.02
R9432:Dchs2 UTSW 3 83,036,032 (GRCm39) missense possibly damaging 0.65
R9445:Dchs2 UTSW 3 83,146,284 (GRCm39) missense probably damaging 0.99
R9466:Dchs2 UTSW 3 83,176,564 (GRCm39) missense probably damaging 1.00
R9612:Dchs2 UTSW 3 83,178,193 (GRCm39) missense probably damaging 0.97
R9622:Dchs2 UTSW 3 83,263,766 (GRCm39) nonsense probably null
R9679:Dchs2 UTSW 3 83,261,697 (GRCm39) missense probably damaging 0.99
R9722:Dchs2 UTSW 3 83,261,301 (GRCm39) missense probably benign 0.01
R9767:Dchs2 UTSW 3 83,212,206 (GRCm39) missense probably benign 0.01
RF012:Dchs2 UTSW 3 83,262,375 (GRCm39) missense probably benign 0.03
Z1177:Dchs2 UTSW 3 83,178,447 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTAGAAGCTACCAACTCTGCCG -3'
(R):5'- CGTTGAGACCCTCATCTCTG -3'

Sequencing Primer
(F):5'- AGCTACCAACTCTGCCGTGTTC -3'
(R):5'- ATCTCTGTCCACGGCAGAC -3'
Posted On 2019-10-24