Incidental Mutation 'R7587:Agl'
ID 587196
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Name amylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms 9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.360) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 116533648-116601815 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116585736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 131 (T131A)
Ref Sequence ENSEMBL: ENSMUSP00000143582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159670] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
AlphaFold F8VPN4
Predicted Effect probably damaging
Transcript: ENSMUST00000040603
AA Change: T131A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: T131A

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159670
SMART Domains Protein: ENSMUSP00000124840
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 7.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159742
AA Change: T131A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: T131A

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161336
AA Change: T131A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400
AA Change: T131A

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162792
AA Change: T131A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: T131A

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116,565,132 (GRCm39) missense probably benign 0.10
IGL00500:Agl APN 3 116,566,469 (GRCm39) missense probably damaging 1.00
IGL00691:Agl APN 3 116,572,907 (GRCm39) missense possibly damaging 0.46
IGL00711:Agl APN 3 116,587,276 (GRCm39) missense probably damaging 1.00
IGL01291:Agl APN 3 116,566,438 (GRCm39) missense possibly damaging 0.49
IGL01641:Agl APN 3 116,578,104 (GRCm39) nonsense probably null
IGL01860:Agl APN 3 116,566,175 (GRCm39) splice site probably benign
IGL01893:Agl APN 3 116,582,198 (GRCm39) missense probably damaging 0.97
IGL02193:Agl APN 3 116,572,815 (GRCm39) missense probably damaging 0.99
IGL02379:Agl APN 3 116,572,740 (GRCm39) missense probably damaging 1.00
IGL02485:Agl APN 3 116,572,729 (GRCm39) missense probably benign
IGL02644:Agl APN 3 116,580,246 (GRCm39) missense probably damaging 1.00
IGL02673:Agl APN 3 116,575,248 (GRCm39) missense probably benign 0.01
IGL02693:Agl APN 3 116,540,077 (GRCm39) missense possibly damaging 0.67
IGL02733:Agl APN 3 116,574,646 (GRCm39) missense probably benign
IGL03089:Agl APN 3 116,574,672 (GRCm39) missense probably damaging 1.00
IGL03271:Agl APN 3 116,572,776 (GRCm39) missense probably benign 0.00
ANU05:Agl UTSW 3 116,566,438 (GRCm39) missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116,565,109 (GRCm39) missense
R0013:Agl UTSW 3 116,570,257 (GRCm39) nonsense probably null
R0013:Agl UTSW 3 116,570,257 (GRCm39) nonsense probably null
R0022:Agl UTSW 3 116,587,485 (GRCm39) splice site probably null
R0092:Agl UTSW 3 116,587,453 (GRCm39) missense probably damaging 1.00
R0226:Agl UTSW 3 116,545,720 (GRCm39) missense probably damaging 1.00
R0440:Agl UTSW 3 116,552,455 (GRCm39) missense probably damaging 1.00
R0488:Agl UTSW 3 116,548,611 (GRCm39) nonsense probably null
R0504:Agl UTSW 3 116,580,433 (GRCm39) missense probably damaging 0.99
R0689:Agl UTSW 3 116,587,277 (GRCm39) missense probably damaging 1.00
R0715:Agl UTSW 3 116,545,825 (GRCm39) missense probably damaging 1.00
R0893:Agl UTSW 3 116,546,935 (GRCm39) missense probably benign 0.04
R1403:Agl UTSW 3 116,576,246 (GRCm39) missense probably benign 0.12
R1403:Agl UTSW 3 116,576,246 (GRCm39) missense probably benign 0.12
R1432:Agl UTSW 3 116,540,342 (GRCm39) missense probably damaging 1.00
R1465:Agl UTSW 3 116,565,021 (GRCm39) missense probably benign 0.35
R1465:Agl UTSW 3 116,565,021 (GRCm39) missense probably benign 0.35
R1540:Agl UTSW 3 116,574,384 (GRCm39) missense probably benign 0.01
R1624:Agl UTSW 3 116,580,895 (GRCm39) missense probably benign 0.30
R1640:Agl UTSW 3 116,545,739 (GRCm39) missense probably benign 0.02
R1834:Agl UTSW 3 116,582,000 (GRCm39) missense probably benign 0.31
R1853:Agl UTSW 3 116,572,971 (GRCm39) nonsense probably null
R2004:Agl UTSW 3 116,574,914 (GRCm39) missense probably damaging 1.00
R2184:Agl UTSW 3 116,574,426 (GRCm39) missense probably benign 0.00
R2227:Agl UTSW 3 116,581,961 (GRCm39) missense possibly damaging 0.78
R3053:Agl UTSW 3 116,584,682 (GRCm39) missense probably damaging 1.00
R4181:Agl UTSW 3 116,540,279 (GRCm39) missense probably damaging 1.00
R4241:Agl UTSW 3 116,548,497 (GRCm39) intron probably benign
R4284:Agl UTSW 3 116,545,827 (GRCm39) missense possibly damaging 0.83
R4285:Agl UTSW 3 116,545,827 (GRCm39) missense possibly damaging 0.83
R4302:Agl UTSW 3 116,540,279 (GRCm39) missense probably damaging 1.00
R4791:Agl UTSW 3 116,580,177 (GRCm39) critical splice donor site probably null
R4854:Agl UTSW 3 116,572,267 (GRCm39) critical splice donor site probably null
R4968:Agl UTSW 3 116,582,175 (GRCm39) missense probably benign 0.31
R5075:Agl UTSW 3 116,587,456 (GRCm39) missense probably damaging 1.00
R5219:Agl UTSW 3 116,572,370 (GRCm39) missense possibly damaging 0.81
R5274:Agl UTSW 3 116,566,135 (GRCm39) missense probably damaging 1.00
R5347:Agl UTSW 3 116,584,814 (GRCm39) missense probably damaging 1.00
R5399:Agl UTSW 3 116,575,277 (GRCm39) missense probably damaging 1.00
R5511:Agl UTSW 3 116,582,209 (GRCm39) missense possibly damaging 0.81
R5763:Agl UTSW 3 116,547,009 (GRCm39) missense probably damaging 1.00
R5827:Agl UTSW 3 116,574,703 (GRCm39) missense probably damaging 1.00
R5964:Agl UTSW 3 116,587,423 (GRCm39) missense probably damaging 1.00
R5967:Agl UTSW 3 116,587,357 (GRCm39) missense probably benign 0.06
R5986:Agl UTSW 3 116,566,145 (GRCm39) missense probably damaging 1.00
R6127:Agl UTSW 3 116,551,978 (GRCm39) missense probably damaging 1.00
R6209:Agl UTSW 3 116,578,845 (GRCm39) nonsense probably null
R6252:Agl UTSW 3 116,580,878 (GRCm39) critical splice donor site probably null
R6337:Agl UTSW 3 116,580,426 (GRCm39) missense possibly damaging 0.65
R6366:Agl UTSW 3 116,584,766 (GRCm39) missense probably damaging 1.00
R6441:Agl UTSW 3 116,565,108 (GRCm39) missense probably benign 0.21
R6647:Agl UTSW 3 116,544,060 (GRCm39) missense probably damaging 1.00
R6678:Agl UTSW 3 116,546,969 (GRCm39) missense probably damaging 0.99
R6736:Agl UTSW 3 116,575,329 (GRCm39) missense probably damaging 0.98
R7141:Agl UTSW 3 116,546,935 (GRCm39) missense probably benign 0.04
R7143:Agl UTSW 3 116,585,670 (GRCm39) missense probably damaging 0.99
R7204:Agl UTSW 3 116,587,469 (GRCm39) missense probably benign 0.04
R7259:Agl UTSW 3 116,578,230 (GRCm39) missense probably damaging 1.00
R7393:Agl UTSW 3 116,584,805 (GRCm39) missense probably benign
R7426:Agl UTSW 3 116,552,404 (GRCm39) missense
R7559:Agl UTSW 3 116,545,764 (GRCm39) missense
R7609:Agl UTSW 3 116,600,928 (GRCm39) missense possibly damaging 0.93
R7657:Agl UTSW 3 116,572,812 (GRCm39) missense
R7715:Agl UTSW 3 116,551,905 (GRCm39) missense
R7735:Agl UTSW 3 116,578,795 (GRCm39) missense probably benign 0.21
R7770:Agl UTSW 3 116,551,886 (GRCm39) critical splice donor site probably null
R7980:Agl UTSW 3 116,585,830 (GRCm39) missense probably benign 0.08
R8186:Agl UTSW 3 116,552,557 (GRCm39) missense possibly damaging 0.92
R8215:Agl UTSW 3 116,582,293 (GRCm39) missense probably damaging 1.00
R8336:Agl UTSW 3 116,566,495 (GRCm39) missense
R8709:Agl UTSW 3 116,566,121 (GRCm39) missense
R9545:Agl UTSW 3 116,582,338 (GRCm39) missense possibly damaging 0.96
X0065:Agl UTSW 3 116,574,979 (GRCm39) nonsense probably null
Z1177:Agl UTSW 3 116,574,685 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGACCCACATAACCTGGTATTTGTAG -3'
(R):5'- GACTTAAGTGGGCCATCAGC -3'

Sequencing Primer
(F):5'- GGAGAGCTGTATCATTGC -3'
(R):5'- GCCATCAGCCTTTGAGATAGAATC -3'
Posted On 2019-10-24