Incidental Mutation 'R7587:Slc1a7'
ID587198
Institutional Source Beutler Lab
Gene Symbol Slc1a7
Ensembl Gene ENSMUSG00000008932
Gene Namesolute carrier family 1 (glutamate transporter), member 7
SynonymsEAAT5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107968332-108013532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108010486 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 457 (I457K)
Ref Sequence ENSEMBL: ENSMUSP00000102324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044248] [ENSMUST00000106708] [ENSMUST00000106709] [ENSMUST00000106713] [ENSMUST00000146851]
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106708
SMART Domains Protein: ENSMUSP00000102319
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106709
SMART Domains Protein: ENSMUSP00000102320
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106713
AA Change: I457K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102324
Gene: ENSMUSG00000008932
AA Change: I457K

DomainStartEndE-ValueType
Pfam:SDF 29 485 1.9e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146851
SMART Domains Protein: ENSMUSP00000121478
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
LRR 1 24 1.19e1 SMART
LRR 47 71 2.84e1 SMART
LRR 94 116 6.22e0 SMART
LRR 117 142 3.47e0 SMART
LRR_TYP 143 166 7.9e-4 SMART
LRR 188 213 1.26e1 SMART
LRR 214 237 2.82e0 SMART
LRR 262 284 1.53e2 SMART
LRR_TYP 285 308 7.37e-4 SMART
low complexity region 319 334 N/A INTRINSIC
low complexity region 359 364 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Slc1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Slc1a7 APN 4 107992965 missense probably damaging 1.00
IGL02643:Slc1a7 APN 4 108012300 missense possibly damaging 0.86
IGL03146:Slc1a7 APN 4 107992992 missense probably damaging 0.98
R1023:Slc1a7 UTSW 4 108007573 missense probably damaging 1.00
R1629:Slc1a7 UTSW 4 108008143 missense probably damaging 1.00
R1869:Slc1a7 UTSW 4 108008364 missense probably damaging 1.00
R1957:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1970:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1971:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R2058:Slc1a7 UTSW 4 108004439 missense probably benign 0.41
R2201:Slc1a7 UTSW 4 107993006 missense probably damaging 1.00
R2212:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3412:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3413:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3414:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3734:Slc1a7 UTSW 4 107977644 missense probably damaging 1.00
R4109:Slc1a7 UTSW 4 107968661 missense probably benign 0.22
R4662:Slc1a7 UTSW 4 108007554 missense probably damaging 1.00
R4676:Slc1a7 UTSW 4 107977674 missense possibly damaging 0.95
R4801:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4802:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4935:Slc1a7 UTSW 4 108007561 missense probably damaging 1.00
R5896:Slc1a7 UTSW 4 108012390 missense probably benign 0.02
R5947:Slc1a7 UTSW 4 108010300 unclassified probably benign
R6056:Slc1a7 UTSW 4 108012261 missense probably benign 0.00
R6088:Slc1a7 UTSW 4 108012444 missense probably damaging 1.00
R6134:Slc1a7 UTSW 4 108012436 missense probably damaging 1.00
R6141:Slc1a7 UTSW 4 108002182 missense possibly damaging 0.50
R7378:Slc1a7 UTSW 4 108002203 missense possibly damaging 0.50
R8002:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8003:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8022:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8023:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGATATCACGACAGAGCC -3'
(R):5'- AGAAGGCTCCATCTTCACTTTTG -3'

Sequencing Primer
(F):5'- AGCATCCTGGTCTCCTTGAAG -3'
(R):5'- CACTTTTGAATTCTGGGACACC -3'
Posted On2019-10-24