Incidental Mutation 'R7587:Rfc3'
ID587202
Institutional Source Beutler Lab
Gene Symbol Rfc3
Ensembl Gene ENSMUSG00000033970
Gene Namereplication factor C (activator 1) 3
Synonyms2810416I22Rik, Recc3, 38kDa, 38kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location151642756-151651242 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 151651151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000039621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038131]
Predicted Effect probably null
Transcript: ENSMUST00000038131
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039621
Gene: ENSMUSG00000033970
AA Change: M1K

DomainStartEndE-ValueType
AAA 34 190 1.5e-6 SMART
Pfam:Rep_fac_C 216 338 7.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Rfc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Rfc3 APN 5 151642936 missense probably benign 0.00
IGL02429:Rfc3 APN 5 151651131 missense probably benign 0.01
IGL02588:Rfc3 APN 5 151642916 missense possibly damaging 0.69
IGL02878:Rfc3 APN 5 151642914 makesense probably null
IGL03109:Rfc3 APN 5 151643094 missense probably benign 0.10
R0129:Rfc3 UTSW 5 151651151 start codon destroyed probably null 1.00
R0456:Rfc3 UTSW 5 151647523 missense possibly damaging 0.61
R2015:Rfc3 UTSW 5 151647538 critical splice acceptor site probably null
R2096:Rfc3 UTSW 5 151644918 missense probably benign 0.03
R2306:Rfc3 UTSW 5 151643778 missense probably damaging 1.00
R4223:Rfc3 UTSW 5 151651172 start gained probably benign
R4739:Rfc3 UTSW 5 151644776 splice site probably benign
R4906:Rfc3 UTSW 5 151647495 missense probably damaging 0.98
R4945:Rfc3 UTSW 5 151642985 missense probably damaging 1.00
R5643:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R5644:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R6011:Rfc3 UTSW 5 151643719 missense probably damaging 1.00
R6181:Rfc3 UTSW 5 151647520 missense probably damaging 1.00
R6885:Rfc3 UTSW 5 151648284 missense probably benign 0.00
R7509:Rfc3 UTSW 5 151647510 missense probably damaging 1.00
Z1088:Rfc3 UTSW 5 151644862 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGAGGAACGCGTCACTC -3'
(R):5'- AATCCAGCGACTGTTGGTGC -3'

Sequencing Primer
(F):5'- AGGAACGCGTCACTCTGACC -3'
(R):5'- CAGTGGTGGAAGTGGGAACTG -3'
Posted On2019-10-24