Incidental Mutation 'R7587:Dennd2a'
ID587203
Institutional Source Beutler Lab
Gene Symbol Dennd2a
Ensembl Gene ENSMUSG00000038456
Gene NameDENN/MADD domain containing 2A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location39462378-39557867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39483135 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 679 (K679Q)
Ref Sequence ENSEMBL: ENSMUSP00000045367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036877]
Predicted Effect probably damaging
Transcript: ENSMUST00000036877
AA Change: K679Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045367
Gene: ENSMUSG00000038456
AA Change: K679Q

DomainStartEndE-ValueType
Blast:DENN 9 430 1e-149 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 508 520 N/A INTRINSIC
uDENN 554 646 2.06e-31 SMART
DENN 653 837 7.1e-76 SMART
dDENN 888 953 1.84e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Dennd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Dennd2a APN 6 39523136 missense probably damaging 1.00
IGL01482:Dennd2a APN 6 39480309 missense probably damaging 0.98
IGL02135:Dennd2a APN 6 39480271 nonsense probably null
IGL02206:Dennd2a APN 6 39523449 missense probably damaging 1.00
IGL02649:Dennd2a APN 6 39470356 missense probably benign 0.11
IGL03057:Dennd2a APN 6 39508248 missense probably damaging 0.98
R0310:Dennd2a UTSW 6 39464201 splice site probably benign
R0326:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R0360:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0364:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0394:Dennd2a UTSW 6 39522812 missense possibly damaging 0.92
R0680:Dennd2a UTSW 6 39483062 missense probably damaging 1.00
R1741:Dennd2a UTSW 6 39493157 missense probably damaging 0.99
R1744:Dennd2a UTSW 6 39480251 missense probably benign 0.26
R2070:Dennd2a UTSW 6 39465119 missense probably damaging 1.00
R3833:Dennd2a UTSW 6 39506717 missense probably damaging 0.97
R3833:Dennd2a UTSW 6 39506723 missense probably damaging 0.98
R4120:Dennd2a UTSW 6 39465096 missense probably damaging 0.99
R4583:Dennd2a UTSW 6 39522842 missense probably damaging 1.00
R4842:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R4887:Dennd2a UTSW 6 39497159 missense probably benign 0.03
R4901:Dennd2a UTSW 6 39522687 missense probably benign 0.00
R5065:Dennd2a UTSW 6 39495176 critical splice donor site probably null
R5413:Dennd2a UTSW 6 39464293 missense probably damaging 1.00
R6181:Dennd2a UTSW 6 39485620 missense probably benign 0.14
R6239:Dennd2a UTSW 6 39488816 missense probably damaging 1.00
R6360:Dennd2a UTSW 6 39493142 missense probably benign 0.01
R7115:Dennd2a UTSW 6 39506711 missense probably damaging 1.00
R7419:Dennd2a UTSW 6 39523463 missense probably damaging 1.00
R7567:Dennd2a UTSW 6 39522809 missense probably benign
R7662:Dennd2a UTSW 6 39493103 missense probably benign 0.03
R7781:Dennd2a UTSW 6 39493066 missense probably damaging 0.99
X0026:Dennd2a UTSW 6 39508367 missense possibly damaging 0.61
Z1177:Dennd2a UTSW 6 39523474 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTGACCACTGAACTGGATGC -3'
(R):5'- GACTTTACGCCCCTACGAAG -3'

Sequencing Primer
(F):5'- ACTGGATGCCCTGCTGAAAGAC -3'
(R):5'- TTTACGCCCCTACGAAGCCATC -3'
Posted On2019-10-24