Incidental Mutation 'R7587:Gucy2c'
ID 587207
Institutional Source Beutler Lab
Gene Symbol Gucy2c
Ensembl Gene ENSMUSG00000042638
Gene Name guanylate cyclase 2c
Synonyms GC-C
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 136674282-136758740 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136681288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 932 (V932A)
Ref Sequence ENSEMBL: ENSMUSP00000032338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]
AlphaFold Q3UWA6
Predicted Effect probably damaging
Transcript: ENSMUST00000032338
AA Change: V932A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: V932A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 113 384 3.7e-8 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 498 744 3.4e-33 PFAM
Pfam:Pkinase 499 744 1e-26 PFAM
CYCc 787 982 2.68e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078095
AA Change: V908A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: V908A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 53 385 2.7e-41 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 475 720 6.5e-32 PFAM
Pfam:Pkinase 480 720 7.2e-25 PFAM
CYCc 763 958 2.68e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Gucy2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Gucy2c APN 6 136,742,612 (GRCm39) missense probably benign 0.01
IGL01081:Gucy2c APN 6 136,679,737 (GRCm39) missense probably damaging 1.00
IGL01285:Gucy2c APN 6 136,686,739 (GRCm39) missense probably damaging 1.00
IGL01395:Gucy2c APN 6 136,675,027 (GRCm39) missense probably damaging 1.00
IGL01408:Gucy2c APN 6 136,675,009 (GRCm39) missense probably benign 0.19
IGL01752:Gucy2c APN 6 136,747,106 (GRCm39) missense probably benign 0.10
IGL01766:Gucy2c APN 6 136,692,971 (GRCm39) missense probably benign 0.43
IGL02245:Gucy2c APN 6 136,706,201 (GRCm39) missense probably benign 0.00
IGL02648:Gucy2c APN 6 136,706,211 (GRCm39) nonsense probably null
IGL02794:Gucy2c APN 6 136,690,146 (GRCm39) missense probably damaging 1.00
IGL03023:Gucy2c APN 6 136,679,794 (GRCm39) splice site probably null
IGL03178:Gucy2c APN 6 136,706,237 (GRCm39) splice site probably benign
IGL03310:Gucy2c APN 6 136,728,044 (GRCm39) missense probably benign
IGL03374:Gucy2c APN 6 136,742,628 (GRCm39) missense probably benign 0.00
IGL03393:Gucy2c APN 6 136,696,665 (GRCm39) missense probably benign 0.04
BB001:Gucy2c UTSW 6 136,740,053 (GRCm39) missense probably benign 0.35
BB011:Gucy2c UTSW 6 136,740,053 (GRCm39) missense probably benign 0.35
R0031:Gucy2c UTSW 6 136,674,997 (GRCm39) missense probably damaging 0.99
R0128:Gucy2c UTSW 6 136,681,247 (GRCm39) missense probably damaging 1.00
R0377:Gucy2c UTSW 6 136,727,915 (GRCm39) critical splice donor site probably null
R0593:Gucy2c UTSW 6 136,705,333 (GRCm39) missense probably damaging 0.99
R0613:Gucy2c UTSW 6 136,737,721 (GRCm39) missense probably damaging 1.00
R0723:Gucy2c UTSW 6 136,704,799 (GRCm39) splice site probably null
R0828:Gucy2c UTSW 6 136,686,746 (GRCm39) missense probably damaging 1.00
R0837:Gucy2c UTSW 6 136,699,418 (GRCm39) missense probably damaging 0.99
R0880:Gucy2c UTSW 6 136,686,830 (GRCm39) critical splice acceptor site probably null
R1350:Gucy2c UTSW 6 136,720,912 (GRCm39) critical splice donor site probably null
R1487:Gucy2c UTSW 6 136,725,824 (GRCm39) missense possibly damaging 0.79
R1680:Gucy2c UTSW 6 136,699,491 (GRCm39) missense probably damaging 1.00
R1751:Gucy2c UTSW 6 136,725,773 (GRCm39) splice site probably benign
R1791:Gucy2c UTSW 6 136,721,025 (GRCm39) missense probably damaging 1.00
R1953:Gucy2c UTSW 6 136,681,291 (GRCm39) missense probably damaging 1.00
R2135:Gucy2c UTSW 6 136,700,726 (GRCm39) missense probably damaging 1.00
R2227:Gucy2c UTSW 6 136,679,758 (GRCm39) missense probably damaging 1.00
R2350:Gucy2c UTSW 6 136,740,072 (GRCm39) missense probably damaging 0.98
R2906:Gucy2c UTSW 6 136,685,385 (GRCm39) missense probably damaging 1.00
R2907:Gucy2c UTSW 6 136,685,385 (GRCm39) missense probably damaging 1.00
R3699:Gucy2c UTSW 6 136,747,109 (GRCm39) missense probably damaging 1.00
R3972:Gucy2c UTSW 6 136,685,364 (GRCm39) missense probably damaging 1.00
R4613:Gucy2c UTSW 6 136,685,319 (GRCm39) missense probably damaging 1.00
R4732:Gucy2c UTSW 6 136,744,150 (GRCm39) missense probably damaging 1.00
R4733:Gucy2c UTSW 6 136,744,150 (GRCm39) missense probably damaging 1.00
R4776:Gucy2c UTSW 6 136,699,512 (GRCm39) missense probably damaging 1.00
R5087:Gucy2c UTSW 6 136,744,033 (GRCm39) missense possibly damaging 0.69
R5284:Gucy2c UTSW 6 136,740,041 (GRCm39) missense possibly damaging 0.56
R5366:Gucy2c UTSW 6 136,697,739 (GRCm39) missense probably damaging 0.99
R5466:Gucy2c UTSW 6 136,758,463 (GRCm39) nonsense probably null
R5911:Gucy2c UTSW 6 136,699,440 (GRCm39) missense probably damaging 1.00
R6160:Gucy2c UTSW 6 136,717,684 (GRCm39) nonsense probably null
R6367:Gucy2c UTSW 6 136,686,776 (GRCm39) missense probably damaging 1.00
R6441:Gucy2c UTSW 6 136,700,759 (GRCm39) missense probably damaging 0.98
R6812:Gucy2c UTSW 6 136,674,993 (GRCm39) missense probably benign
R6865:Gucy2c UTSW 6 136,747,127 (GRCm39) missense probably benign 0.13
R7065:Gucy2c UTSW 6 136,697,764 (GRCm39) missense probably damaging 1.00
R7078:Gucy2c UTSW 6 136,674,937 (GRCm39) missense probably benign 0.19
R7096:Gucy2c UTSW 6 136,705,339 (GRCm39) missense probably benign 0.11
R7138:Gucy2c UTSW 6 136,705,342 (GRCm39) missense probably damaging 1.00
R7343:Gucy2c UTSW 6 136,679,746 (GRCm39) missense probably damaging 1.00
R7538:Gucy2c UTSW 6 136,686,742 (GRCm39) missense probably damaging 1.00
R7666:Gucy2c UTSW 6 136,674,966 (GRCm39) missense probably benign
R7675:Gucy2c UTSW 6 136,693,030 (GRCm39) missense possibly damaging 0.91
R7822:Gucy2c UTSW 6 136,685,404 (GRCm39) missense probably damaging 1.00
R7842:Gucy2c UTSW 6 136,746,814 (GRCm39) splice site probably null
R7924:Gucy2c UTSW 6 136,740,053 (GRCm39) missense probably benign 0.35
R8078:Gucy2c UTSW 6 136,674,919 (GRCm39) missense probably damaging 1.00
R8094:Gucy2c UTSW 6 136,714,446 (GRCm39) missense probably benign 0.33
R8391:Gucy2c UTSW 6 136,681,213 (GRCm39) missense probably damaging 1.00
R8428:Gucy2c UTSW 6 136,704,892 (GRCm39) missense probably damaging 0.96
R9188:Gucy2c UTSW 6 136,700,756 (GRCm39) missense probably benign 0.44
R9189:Gucy2c UTSW 6 136,728,045 (GRCm39) missense probably benign
R9325:Gucy2c UTSW 6 136,743,992 (GRCm39) nonsense probably null
R9361:Gucy2c UTSW 6 136,714,429 (GRCm39) missense possibly damaging 0.80
R9413:Gucy2c UTSW 6 136,700,771 (GRCm39) missense possibly damaging 0.94
Z1088:Gucy2c UTSW 6 136,720,979 (GRCm39) missense probably benign
Z1177:Gucy2c UTSW 6 136,744,194 (GRCm39) missense probably benign 0.01
Z1177:Gucy2c UTSW 6 136,696,685 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTCTAGCCCTGTGAGG -3'
(R):5'- GTGACCTGGACCTCTGAATG -3'

Sequencing Primer
(F):5'- GTCCTCACTCTGGCACTGG -3'
(R):5'- GTGTTCTTTGCTATAACAAAAGCCC -3'
Posted On 2019-10-24