Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Gucy2c'

587207

Institutional Source

Beutler Lab

Gene Symbol

Gucy2c

Ensembl Gene

ENSMUSG00000042638

Gene Name

guanylate cyclase 2c

Synonyms

GC-C

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136697284-136781765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136704290 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 932 (V932A)

Ref Sequence

ENSEMBL: ENSMUSP00000032338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]

AlphaFold

Q3UWA6

Predicted Effect

probably damaging
Transcript: ENSMUST00000032338
AA Change: V932A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: V932A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	113	384	3.7e-8	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	498	744	3.4e-33	PFAM
Pfam:Pkinase	499	744	1e-26	PFAM
CYCc	787	982	2.68e-107	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000078095
AA Change: V908A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: V908A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	53	385	2.7e-41	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	475	720	6.5e-32	PFAM
Pfam:Pkinase	480	720	7.2e-25	PFAM
CYCc	763	958	2.68e-107	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Gucy2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00849:Gucy2c	APN	6	136765614	missense	probably benign	0.01
IGL01081:Gucy2c	APN	6	136702739	missense	probably damaging	1.00
IGL01285:Gucy2c	APN	6	136709741	missense	probably damaging	1.00
IGL01395:Gucy2c	APN	6	136698029	missense	probably damaging	1.00
IGL01408:Gucy2c	APN	6	136698011	missense	probably benign	0.19
IGL01752:Gucy2c	APN	6	136770108	missense	probably benign	0.10
IGL01766:Gucy2c	APN	6	136715973	missense	probably benign	0.43
IGL02245:Gucy2c	APN	6	136729203	missense	probably benign	0.00
IGL02648:Gucy2c	APN	6	136729213	nonsense	probably null
IGL02794:Gucy2c	APN	6	136713148	missense	probably damaging	1.00
IGL03023:Gucy2c	APN	6	136702796	splice site	probably null
IGL03178:Gucy2c	APN	6	136729239	splice site	probably benign
IGL03310:Gucy2c	APN	6	136751046	missense	probably benign
IGL03374:Gucy2c	APN	6	136765630	missense	probably benign	0.00
IGL03393:Gucy2c	APN	6	136719667	missense	probably benign	0.04
BB001:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
BB011:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
R0031:Gucy2c	UTSW	6	136697999	missense	probably damaging	0.99
R0128:Gucy2c	UTSW	6	136704249	missense	probably damaging	1.00
R0377:Gucy2c	UTSW	6	136750917	critical splice donor site	probably null
R0593:Gucy2c	UTSW	6	136728335	missense	probably damaging	0.99
R0613:Gucy2c	UTSW	6	136760723	missense	probably damaging	1.00
R0723:Gucy2c	UTSW	6	136727801	splice site	probably null
R0828:Gucy2c	UTSW	6	136709748	missense	probably damaging	1.00
R0837:Gucy2c	UTSW	6	136722420	missense	probably damaging	0.99
R0880:Gucy2c	UTSW	6	136709832	critical splice acceptor site	probably null
R1350:Gucy2c	UTSW	6	136743914	critical splice donor site	probably null
R1487:Gucy2c	UTSW	6	136748826	missense	possibly damaging	0.79
R1680:Gucy2c	UTSW	6	136722493	missense	probably damaging	1.00
R1751:Gucy2c	UTSW	6	136748775	splice site	probably benign
R1791:Gucy2c	UTSW	6	136744027	missense	probably damaging	1.00
R1953:Gucy2c	UTSW	6	136704293	missense	probably damaging	1.00
R2135:Gucy2c	UTSW	6	136723728	missense	probably damaging	1.00
R2227:Gucy2c	UTSW	6	136702760	missense	probably damaging	1.00
R2350:Gucy2c	UTSW	6	136763074	missense	probably damaging	0.98
R2906:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R2907:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R3699:Gucy2c	UTSW	6	136770111	missense	probably damaging	1.00
R3972:Gucy2c	UTSW	6	136708366	missense	probably damaging	1.00
R4613:Gucy2c	UTSW	6	136708321	missense	probably damaging	1.00
R4732:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4733:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4776:Gucy2c	UTSW	6	136722514	missense	probably damaging	1.00
R5087:Gucy2c	UTSW	6	136767035	missense	possibly damaging	0.69
R5284:Gucy2c	UTSW	6	136763043	missense	possibly damaging	0.56
R5366:Gucy2c	UTSW	6	136720741	missense	probably damaging	0.99
R5466:Gucy2c	UTSW	6	136781465	nonsense	probably null
R5911:Gucy2c	UTSW	6	136722442	missense	probably damaging	1.00
R6160:Gucy2c	UTSW	6	136740686	nonsense	probably null
R6367:Gucy2c	UTSW	6	136709778	missense	probably damaging	1.00
R6441:Gucy2c	UTSW	6	136723761	missense	probably damaging	0.98
R6812:Gucy2c	UTSW	6	136697995	missense	probably benign
R6865:Gucy2c	UTSW	6	136770129	missense	probably benign	0.13
R7065:Gucy2c	UTSW	6	136720766	missense	probably damaging	1.00
R7078:Gucy2c	UTSW	6	136697939	missense	probably benign	0.19
R7096:Gucy2c	UTSW	6	136728341	missense	probably benign	0.11
R7138:Gucy2c	UTSW	6	136728344	missense	probably damaging	1.00
R7343:Gucy2c	UTSW	6	136702748	missense	probably damaging	1.00
R7538:Gucy2c	UTSW	6	136709744	missense	probably damaging	1.00
R7666:Gucy2c	UTSW	6	136697968	missense	probably benign
R7675:Gucy2c	UTSW	6	136716032	missense	possibly damaging	0.91
R7822:Gucy2c	UTSW	6	136708406	missense	probably damaging	1.00
R7842:Gucy2c	UTSW	6	136769816	splice site	probably null
R7924:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
R8078:Gucy2c	UTSW	6	136697921	missense	probably damaging	1.00
R8094:Gucy2c	UTSW	6	136737448	missense	probably benign	0.33
R8391:Gucy2c	UTSW	6	136704215	missense	probably damaging	1.00
R8428:Gucy2c	UTSW	6	136727894	missense	probably damaging	0.96
R9188:Gucy2c	UTSW	6	136723758	missense	probably benign	0.44
R9189:Gucy2c	UTSW	6	136751047	missense	probably benign
R9325:Gucy2c	UTSW	6	136766994	nonsense	probably null
R9361:Gucy2c	UTSW	6	136737431	missense	possibly damaging	0.80
R9413:Gucy2c	UTSW	6	136723773	missense	possibly damaging	0.94
Z1088:Gucy2c	UTSW	6	136743981	missense	probably benign
Z1177:Gucy2c	UTSW	6	136719687	missense	probably damaging	1.00
Z1177:Gucy2c	UTSW	6	136767196	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCAAGTCTAGCCCTGTGAGG -3'
(R):5'- GTGACCTGGACCTCTGAATG -3'

Sequencing Primer
(F):5'- GTCCTCACTCTGGCACTGG -3'
(R):5'- GTGTTCTTTGCTATAACAAAAGCCC -3'

Posted On

2019-10-24