Incidental Mutation 'R7587:Tlnrd1'
ID587210
Institutional Source Beutler Lab
Gene Symbol Tlnrd1
Ensembl Gene ENSMUSG00000070462
Gene Nametalin rod domain containing 1
SynonymsMesdc1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location83879873-83884305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83882947 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 92 (L92P)
Ref Sequence ENSEMBL: ENSMUSP00000091769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094216]
Predicted Effect probably damaging
Transcript: ENSMUST00000094216
AA Change: L92P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091769
Gene: ENSMUSG00000070462
AA Change: L92P

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
PDB:2X0C|A 37 320 1e-21 PDB
Blast:MA 100 258 1e-5 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is regulated by micro RNA MiR-574-3, and is thought to have an oncogenic function in human bladder cancer. A similar gene in mouse is located in a chromosomal region critical for differentiation of mesoderm, which affects embryo patterning and the formation of heart, muscle, blood, skeleton and the urogenital system. The mouse gene is expressed in early development, and in the adult. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Tlnrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Tlnrd1 APN 7 83882846 missense probably damaging 1.00
IGL02662:Tlnrd1 APN 7 83882819 missense possibly damaging 0.94
IGL02662:Tlnrd1 APN 7 83882536 missense probably damaging 1.00
Danken UTSW 7 83882630 missense probably damaging 0.97
fallt UTSW 7 83882779 missense probably damaging 1.00
R2096:Tlnrd1 UTSW 7 83882854 missense probably benign 0.05
R2358:Tlnrd1 UTSW 7 83882280 missense probably benign 0.00
R5429:Tlnrd1 UTSW 7 83882314 missense probably damaging 1.00
R5910:Tlnrd1 UTSW 7 83884485 unclassified probably benign
R6004:Tlnrd1 UTSW 7 83882779 missense probably damaging 1.00
R6931:Tlnrd1 UTSW 7 83882597 missense probably benign 0.15
R7000:Tlnrd1 UTSW 7 83882779 missense probably damaging 1.00
R7481:Tlnrd1 UTSW 7 83882338 missense probably damaging 1.00
R7598:Tlnrd1 UTSW 7 83882630 missense probably damaging 0.97
R8047:Tlnrd1 UTSW 7 83882861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCACAGCCTTGTTCTACC -3'
(R):5'- CTGGTATCTATCTGTGATCACTGCAAG -3'

Sequencing Primer
(F):5'- ACACGGTAGCGGTCCACAAG -3'
(R):5'- CTGCTGCTGTCTAGCGA -3'
Posted On2019-10-24