Incidental Mutation 'R7587:Nox4'
ID 587211
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene Name NADPH oxidase 4
Synonyms
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86895304-87047918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86966510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 207 (H207R)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
AlphaFold Q9JHI8
Predicted Effect probably damaging
Transcript: ENSMUST00000032781
AA Change: H207R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: H207R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068829
AA Change: H207R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: H207R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87,025,424 (GRCm39) missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87,046,076 (GRCm39) missense probably damaging 1.00
IGL03234:Nox4 APN 7 86,966,521 (GRCm39) critical splice donor site probably null
IGL03286:Nox4 APN 7 87,019,349 (GRCm39) splice site probably benign
BB001:Nox4 UTSW 7 87,023,589 (GRCm39) missense probably benign 0.00
BB011:Nox4 UTSW 7 87,023,589 (GRCm39) missense probably benign 0.00
LCD18:Nox4 UTSW 7 86,892,275 (GRCm39) unclassified probably benign
PIT4151001:Nox4 UTSW 7 86,954,097 (GRCm39) missense probably benign 0.02
R0717:Nox4 UTSW 7 86,954,098 (GRCm39) nonsense probably null
R1033:Nox4 UTSW 7 87,023,621 (GRCm39) missense probably damaging 0.99
R1135:Nox4 UTSW 7 86,972,997 (GRCm39) missense probably damaging 1.00
R1333:Nox4 UTSW 7 86,896,072 (GRCm39) missense possibly damaging 0.80
R1477:Nox4 UTSW 7 86,945,074 (GRCm39) missense probably benign 0.16
R1489:Nox4 UTSW 7 86,954,097 (GRCm39) missense probably damaging 0.99
R1579:Nox4 UTSW 7 87,019,231 (GRCm39) missense probably damaging 0.98
R1669:Nox4 UTSW 7 86,945,097 (GRCm39) missense probably benign 0.01
R1742:Nox4 UTSW 7 86,945,026 (GRCm39) missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87,010,004 (GRCm39) nonsense probably null
R2112:Nox4 UTSW 7 87,021,216 (GRCm39) missense probably damaging 1.00
R2192:Nox4 UTSW 7 87,023,588 (GRCm39) missense probably benign 0.02
R2496:Nox4 UTSW 7 86,955,958 (GRCm39) missense probably benign 0.04
R2497:Nox4 UTSW 7 86,945,084 (GRCm39) nonsense probably null
R4158:Nox4 UTSW 7 87,046,032 (GRCm39) missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87,046,032 (GRCm39) missense possibly damaging 0.95
R4281:Nox4 UTSW 7 86,946,732 (GRCm39) missense possibly damaging 0.77
R4685:Nox4 UTSW 7 86,946,716 (GRCm39) missense probably benign 0.36
R4791:Nox4 UTSW 7 86,954,055 (GRCm39) missense probably benign 0.35
R5001:Nox4 UTSW 7 87,010,011 (GRCm39) missense probably damaging 0.96
R5091:Nox4 UTSW 7 87,025,450 (GRCm39) missense probably damaging 1.00
R5174:Nox4 UTSW 7 86,972,974 (GRCm39) missense probably benign 0.10
R5220:Nox4 UTSW 7 87,023,616 (GRCm39) missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87,021,134 (GRCm39) missense probably damaging 1.00
R5723:Nox4 UTSW 7 86,954,181 (GRCm39) intron probably benign
R5840:Nox4 UTSW 7 87,010,001 (GRCm39) missense probably benign 0.00
R5852:Nox4 UTSW 7 86,988,172 (GRCm39) missense probably damaging 0.98
R7516:Nox4 UTSW 7 86,970,905 (GRCm39) missense probably benign
R7529:Nox4 UTSW 7 87,044,976 (GRCm39) missense unknown
R7643:Nox4 UTSW 7 86,972,962 (GRCm39) missense probably damaging 1.00
R7660:Nox4 UTSW 7 87,019,230 (GRCm39) missense probably damaging 0.97
R7786:Nox4 UTSW 7 86,945,050 (GRCm39) missense probably damaging 0.99
R7871:Nox4 UTSW 7 86,963,335 (GRCm39) missense possibly damaging 0.95
R7924:Nox4 UTSW 7 87,023,589 (GRCm39) missense probably benign 0.00
R7934:Nox4 UTSW 7 86,945,032 (GRCm39) missense probably damaging 1.00
R8024:Nox4 UTSW 7 86,954,118 (GRCm39) missense probably damaging 0.99
R8053:Nox4 UTSW 7 87,019,255 (GRCm39) missense probably damaging 1.00
R8269:Nox4 UTSW 7 86,955,930 (GRCm39) splice site probably benign
R8376:Nox4 UTSW 7 87,023,592 (GRCm39) missense probably damaging 1.00
R8461:Nox4 UTSW 7 86,966,479 (GRCm39) missense probably damaging 0.99
R9041:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9100:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9101:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9102:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9109:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9135:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9136:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9220:Nox4 UTSW 7 86,970,774 (GRCm39) missense probably benign 0.01
R9252:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9298:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9306:Nox4 UTSW 7 86,896,781 (GRCm39) missense probably benign 0.01
R9338:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9339:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9448:Nox4 UTSW 7 87,045,001 (GRCm39) missense unknown
X0021:Nox4 UTSW 7 87,044,886 (GRCm39) missense probably damaging 1.00
Z1177:Nox4 UTSW 7 87,044,920 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGCCATCAATTGGGATGC -3'
(R):5'- CGGCTATCAGTTCCTGTAGATAGG -3'

Sequencing Primer
(F):5'- TGCTTAATTCCAGCACTCAGGAGG -3'
(R):5'- AGTTCCTGTAGATAGGATAATGATGG -3'
Posted On 2019-10-24