Incidental Mutation 'R7587:Olfr668'
ID587212
Institutional Source Beutler Lab
Gene Symbol Olfr668
Ensembl Gene ENSMUSG00000057770
Gene Nameolfactory receptor 668
SynonymsGA_x6K02T2PBJ9-7554614-7553658, MOR34-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104922291-104928057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104925056 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 236 (R236H)
Ref Sequence ENSEMBL: ENSMUSP00000150824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164391] [ENSMUST00000215359] [ENSMUST00000217177]
Predicted Effect probably benign
Transcript: ENSMUST00000164391
AA Change: R236H

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130975
Gene: ENSMUSG00000057770
AA Change: R236H

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 7.2e-103 PFAM
Pfam:7TM_GPCR_Srsx 37 210 4.7e-10 PFAM
Pfam:7tm_1 43 295 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215359
AA Change: R236H

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217177
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Olfr668
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Olfr668 APN 7 104925104 missense probably damaging 1.00
IGL02250:Olfr668 APN 7 104925015 missense probably damaging 1.00
IGL02743:Olfr668 APN 7 104924868 missense probably damaging 0.98
IGL03105:Olfr668 APN 7 104925764 unclassified probably benign
IGL03252:Olfr668 APN 7 104925387 missense probably benign 0.16
IGL03387:Olfr668 APN 7 104925373 missense probably benign 0.01
R1534:Olfr668 UTSW 7 104925414 missense possibly damaging 0.95
R2509:Olfr668 UTSW 7 104925687 missense probably benign 0.40
R2510:Olfr668 UTSW 7 104925687 missense probably benign 0.40
R4739:Olfr668 UTSW 7 104924810 missense possibly damaging 0.91
R4995:Olfr668 UTSW 7 104925735 missense probably benign 0.01
R5071:Olfr668 UTSW 7 104925493 missense probably benign
R5074:Olfr668 UTSW 7 104925493 missense probably benign
R5208:Olfr668 UTSW 7 104925726 missense probably benign
R5293:Olfr668 UTSW 7 104925279 missense probably benign 0.00
R6061:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6063:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6064:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6172:Olfr668 UTSW 7 104925296 missense probably benign 0.40
R6492:Olfr668 UTSW 7 104925645 missense possibly damaging 0.60
R6933:Olfr668 UTSW 7 104925123 missense probably benign 0.21
R7040:Olfr668 UTSW 7 104925510 missense probably benign 0.02
R7841:Olfr668 UTSW 7 104924859 missense possibly damaging 0.59
R7869:Olfr668 UTSW 7 104925104 missense probably damaging 1.00
R7902:Olfr668 UTSW 7 104925350 missense probably damaging 1.00
R7924:Olfr668 UTSW 7 104924859 missense possibly damaging 0.59
R7952:Olfr668 UTSW 7 104925104 missense probably damaging 1.00
R7985:Olfr668 UTSW 7 104925350 missense probably damaging 1.00
Z1177:Olfr668 UTSW 7 104924993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGGTCTTGACTCCATAAAC -3'
(R):5'- GCGCTTGCCCTATTGTAGAAG -3'

Sequencing Primer
(F):5'- GGTCTTGACTCCATAAACAATTGGG -3'
(R):5'- GCTTGCCCTATTGTAGAAGCATTC -3'
Posted On2019-10-24