Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Robo3'

587216

Institutional Source

Beutler Lab

Gene Symbol

Robo3

Ensembl Gene

ENSMUSG00000032128

Gene Name

roundabout guidance receptor 3

Synonyms

Rig1, Rig-1, Robo3b, Robo3a, Rbig1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37415669-37433246 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37429646 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 110 (D110G)

Ref Sequence

ENSEMBL: ENSMUSP00000110690 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000115038] [ENSMUST00000170512]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034643
AA Change: D88G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128
AA Change: D88G

Domain	Start	End	E-Value	Type
IGc2	54	128	9.7e-11	SMART
IGc2	156	221	1.44e-4	SMART
IGc2	248	311	1.89e-13	SMART
IGc2	337	409	9.84e-12	SMART
IGc2	441	506	2.09e-15	SMART
FN3	534	616	4.24e-14	SMART
FN3	648	731	3.06e0	SMART
FN3	747	832	1.97e-9	SMART
low complexity region	870	890	N/A	INTRINSIC
low complexity region	1055	1082	N/A	INTRINSIC
low complexity region	1131	1149	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC
low complexity region	1193	1206	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1336	1376	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115038
AA Change: D110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128
AA Change: D110G

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
IGc2	76	150	9.7e-11	SMART
IGc2	178	243	1.44e-4	SMART
IGc2	270	333	1.89e-13	SMART
IGc2	359	431	9.84e-12	SMART
IGc2	463	528	2.09e-15	SMART
FN3	556	638	4.24e-14	SMART
FN3	670	753	3.06e0	SMART
FN3	769	854	1.97e-9	SMART
low complexity region	892	912	N/A	INTRINSIC
low complexity region	1077	1104	N/A	INTRINSIC
low complexity region	1153	1171	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
low complexity region	1215	1228	N/A	INTRINSIC
low complexity region	1267	1278	N/A	INTRINSIC
low complexity region	1290	1303	N/A	INTRINSIC
low complexity region	1358	1398	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170512
AA Change: D88G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal commissural axon growth, and fragile floor plates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Robo3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Robo3	APN	9	37427754	critical splice donor site	probably null
IGL01023:Robo3	APN	9	37429551	missense	probably damaging	1.00
IGL01431:Robo3	APN	9	37419111	unclassified	probably benign
IGL01993:Robo3	APN	9	37424653	missense	probably damaging	1.00
IGL02256:Robo3	APN	9	37425353	missense	probably damaging	1.00
IGL02323:Robo3	APN	9	37422201	missense	probably benign	0.05
IGL02561:Robo3	APN	9	37427091	missense	possibly damaging	0.84
IGL02866:Robo3	APN	9	37422306	missense	possibly damaging	0.89
IGL02897:Robo3	APN	9	37427502	nonsense	probably null
IGL03003:Robo3	APN	9	37419291	missense	probably damaging	1.00
IGL03307:Robo3	APN	9	37422564	missense	probably damaging	0.96
IGL03097:Robo3	UTSW	9	37422528	critical splice donor site	probably null
R0137:Robo3	UTSW	9	37425344	missense	probably benign	0.00
R0266:Robo3	UTSW	9	37422640	missense	probably damaging	0.96
R0390:Robo3	UTSW	9	37422177	missense	probably benign	0.00
R0505:Robo3	UTSW	9	37416759	unclassified	probably benign
R0815:Robo3	UTSW	9	37422183	missense	probably damaging	1.00
R0924:Robo3	UTSW	9	37429482	splice site	probably benign
R1167:Robo3	UTSW	9	37423907	nonsense	probably null
R1203:Robo3	UTSW	9	37418682	missense	probably damaging	1.00
R1451:Robo3	UTSW	9	37417711	missense	probably benign	0.01
R1575:Robo3	UTSW	9	37429661	missense	probably damaging	1.00
R1596:Robo3	UTSW	9	37424632	critical splice donor site	probably null
R1660:Robo3	UTSW	9	37429144	missense	probably damaging	1.00
R1677:Robo3	UTSW	9	37417709	missense	possibly damaging	0.75
R1839:Robo3	UTSW	9	37422327	missense	probably benign	0.00
R1878:Robo3	UTSW	9	37422165	missense	probably damaging	1.00
R1891:Robo3	UTSW	9	37428055	missense	probably damaging	1.00
R2040:Robo3	UTSW	9	37427464	missense	probably damaging	1.00
R2859:Robo3	UTSW	9	37428104	nonsense	probably null
R3786:Robo3	UTSW	9	37422225	missense	probably damaging	1.00
R3886:Robo3	UTSW	9	37422181	nonsense	probably null
R3888:Robo3	UTSW	9	37422181	nonsense	probably null
R3910:Robo3	UTSW	9	37419295	missense	probably damaging	1.00
R4212:Robo3	UTSW	9	37421898	missense	probably damaging	1.00
R4213:Robo3	UTSW	9	37421898	missense	probably damaging	1.00
R4691:Robo3	UTSW	9	37425218	missense	probably damaging	0.99
R4979:Robo3	UTSW	9	37423344	missense	probably damaging	1.00
R5238:Robo3	UTSW	9	37416879	missense	probably damaging	0.99
R5570:Robo3	UTSW	9	37425275	missense	possibly damaging	0.81
R5629:Robo3	UTSW	9	37419211	nonsense	probably null
R5770:Robo3	UTSW	9	37419201	missense	possibly damaging	0.87
R5837:Robo3	UTSW	9	37429816	critical splice acceptor site	probably null
R6021:Robo3	UTSW	9	37422533	nonsense	probably null
R6129:Robo3	UTSW	9	37423293	missense	probably benign
R6232:Robo3	UTSW	9	37420929	missense	probably damaging	1.00
R6233:Robo3	UTSW	9	37420929	missense	probably damaging	1.00
R6235:Robo3	UTSW	9	37420929	missense	probably damaging	1.00
R6326:Robo3	UTSW	9	37427027	missense	probably damaging	1.00
R6354:Robo3	UTSW	9	37417217	unclassified	probably benign
R6355:Robo3	UTSW	9	37418939	missense	possibly damaging	0.71
R6475:Robo3	UTSW	9	37423290	missense	probably damaging	0.99
R6937:Robo3	UTSW	9	37429880	missense	probably benign	0.16
R7201:Robo3	UTSW	9	37424330	nonsense	probably null
R7208:Robo3	UTSW	9	37424724	missense	probably damaging	0.99
R7249:Robo3	UTSW	9	37424833	missense	probably benign
R7376:Robo3	UTSW	9	37432916	missense	probably damaging	1.00
R7380:Robo3	UTSW	9	37418556	missense	probably damaging	1.00
R7448:Robo3	UTSW	9	37424815	missense	possibly damaging	0.89
R7475:Robo3	UTSW	9	37425378	missense	probably benign	0.01
R7496:Robo3	UTSW	9	37427825	missense	probably damaging	1.00
R7694:Robo3	UTSW	9	37418520	missense	probably benign	0.14
R8381:Robo3	UTSW	9	37429760	missense	probably damaging	1.00
R8464:Robo3	UTSW	9	37421430	missense	probably damaging	1.00
R8495:Robo3	UTSW	9	37425368	missense	probably damaging	1.00
R8886:Robo3	UTSW	9	37417472	missense	probably damaging	0.99
R9422:Robo3	UTSW	9	37418493	missense	probably benign	0.03
R9563:Robo3	UTSW	9	37429604	missense	probably damaging	1.00
R9564:Robo3	UTSW	9	37429604	missense	probably damaging	1.00
R9681:Robo3	UTSW	9	37423262	missense	possibly damaging	0.75
R9681:Robo3	UTSW	9	37427791	missense	probably benign	0.45
X0024:Robo3	UTSW	9	37427855	missense	probably damaging	1.00
X0027:Robo3	UTSW	9	37427825	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCCCCAGGTTCTAGAAG -3'
(R):5'- TGCCTGGGTACTTGGAGTTACC -3'

Sequencing Primer
(F):5'- GCCCCAGGTTCTAGAAGCATCAG -3'
(R):5'- ACCTTCTTCTCCAGGGTCAAGAG -3'

Posted On

2019-10-24