Incidental Mutation 'R7587:Robo3'
ID587216
Institutional Source Beutler Lab
Gene Symbol Robo3
Ensembl Gene ENSMUSG00000032128
Gene Nameroundabout guidance receptor 3
SynonymsRig1, Rig-1, Robo3b, Robo3a, Rbig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37415669-37433246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37429646 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 110 (D110G)
Ref Sequence ENSEMBL: ENSMUSP00000110690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000115038] [ENSMUST00000170512]
Predicted Effect probably damaging
Transcript: ENSMUST00000034643
AA Change: D88G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128
AA Change: D88G

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115038
AA Change: D110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128
AA Change: D110G

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170512
AA Change: D88G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal commissural axon growth, and fragile floor plates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Kdm3b A G 18: 34,797,027 probably null Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lpp A T 16: 24,762,279 probably null Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Ncbp3 T C 11: 73,066,765 probably null Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Robo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Robo3 APN 9 37427754 critical splice donor site probably null
IGL01023:Robo3 APN 9 37429551 missense probably damaging 1.00
IGL01431:Robo3 APN 9 37419111 unclassified probably benign
IGL01993:Robo3 APN 9 37424653 missense probably damaging 1.00
IGL02256:Robo3 APN 9 37425353 missense probably damaging 1.00
IGL02323:Robo3 APN 9 37422201 missense probably benign 0.05
IGL02561:Robo3 APN 9 37427091 missense possibly damaging 0.84
IGL02866:Robo3 APN 9 37422306 missense possibly damaging 0.89
IGL02897:Robo3 APN 9 37427502 nonsense probably null
IGL03003:Robo3 APN 9 37419291 missense probably damaging 1.00
IGL03307:Robo3 APN 9 37422564 missense probably damaging 0.96
IGL03097:Robo3 UTSW 9 37422528 critical splice donor site probably null
R0137:Robo3 UTSW 9 37425344 missense probably benign 0.00
R0266:Robo3 UTSW 9 37422640 missense probably damaging 0.96
R0390:Robo3 UTSW 9 37422177 missense probably benign 0.00
R0505:Robo3 UTSW 9 37416759 unclassified probably benign
R0815:Robo3 UTSW 9 37422183 missense probably damaging 1.00
R0924:Robo3 UTSW 9 37429482 splice site probably benign
R1167:Robo3 UTSW 9 37423907 nonsense probably null
R1203:Robo3 UTSW 9 37418682 missense probably damaging 1.00
R1451:Robo3 UTSW 9 37417711 missense probably benign 0.01
R1575:Robo3 UTSW 9 37429661 missense probably damaging 1.00
R1596:Robo3 UTSW 9 37424632 critical splice donor site probably null
R1660:Robo3 UTSW 9 37429144 missense probably damaging 1.00
R1677:Robo3 UTSW 9 37417709 missense possibly damaging 0.75
R1839:Robo3 UTSW 9 37422327 missense probably benign 0.00
R1878:Robo3 UTSW 9 37422165 missense probably damaging 1.00
R1891:Robo3 UTSW 9 37428055 missense probably damaging 1.00
R2040:Robo3 UTSW 9 37427464 missense probably damaging 1.00
R2859:Robo3 UTSW 9 37428104 nonsense probably null
R3786:Robo3 UTSW 9 37422225 missense probably damaging 1.00
R3886:Robo3 UTSW 9 37422181 nonsense probably null
R3888:Robo3 UTSW 9 37422181 nonsense probably null
R3910:Robo3 UTSW 9 37419295 missense probably damaging 1.00
R4212:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4213:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4691:Robo3 UTSW 9 37425218 missense probably damaging 0.99
R4979:Robo3 UTSW 9 37423344 missense probably damaging 1.00
R5238:Robo3 UTSW 9 37416879 missense probably damaging 0.99
R5570:Robo3 UTSW 9 37425275 missense possibly damaging 0.81
R5629:Robo3 UTSW 9 37419211 nonsense probably null
R5770:Robo3 UTSW 9 37419201 missense possibly damaging 0.87
R5837:Robo3 UTSW 9 37429816 critical splice acceptor site probably null
R6021:Robo3 UTSW 9 37422533 nonsense probably null
R6129:Robo3 UTSW 9 37423293 missense probably benign
R6232:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6233:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6235:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6326:Robo3 UTSW 9 37427027 missense probably damaging 1.00
R6354:Robo3 UTSW 9 37417217 unclassified probably benign
R6355:Robo3 UTSW 9 37418939 missense possibly damaging 0.71
R6475:Robo3 UTSW 9 37423290 missense probably damaging 0.99
R6937:Robo3 UTSW 9 37429880 missense probably benign 0.16
R7201:Robo3 UTSW 9 37424330 nonsense probably null
R7208:Robo3 UTSW 9 37424724 missense probably damaging 0.99
R7249:Robo3 UTSW 9 37424833 missense probably benign
R7376:Robo3 UTSW 9 37432916 missense probably damaging 1.00
R7380:Robo3 UTSW 9 37418556 missense probably damaging 1.00
R7448:Robo3 UTSW 9 37424815 missense possibly damaging 0.89
R7475:Robo3 UTSW 9 37425378 missense probably benign 0.01
R7496:Robo3 UTSW 9 37427825 missense probably damaging 1.00
R7694:Robo3 UTSW 9 37418520 missense probably benign 0.14
R8381:Robo3 UTSW 9 37429760 missense probably damaging 1.00
R8464:Robo3 UTSW 9 37421430 missense probably damaging 1.00
R8495:Robo3 UTSW 9 37425368 missense probably damaging 1.00
R8886:Robo3 UTSW 9 37417472 missense probably damaging 0.99
X0024:Robo3 UTSW 9 37427855 missense probably damaging 1.00
X0027:Robo3 UTSW 9 37427825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCCCAGGTTCTAGAAG -3'
(R):5'- TGCCTGGGTACTTGGAGTTACC -3'

Sequencing Primer
(F):5'- GCCCCAGGTTCTAGAAGCATCAG -3'
(R):5'- ACCTTCTTCTCCAGGGTCAAGAG -3'
Posted On2019-10-24