Mutagenetix > Incidental Mutations

Incidental Mutation 'R7587:Lipc'

587217

Institutional Source

Beutler Lab

Gene Symbol

Lipc

Ensembl Gene

ENSMUSG00000032207

Gene Name

lipase, hepatic

Synonyms

Hpl, HL

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70798128-70952226 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70818924 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 168 (Y168H)

Ref Sequence

ENSEMBL: ENSMUSP00000034731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000214995] [ENSMUST00000216798]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034731
AA Change: Y168H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: Y168H

Domain	Start	End	E-Value	Type
Pfam:Lipase	14	350	1.1e-136	PFAM
LH2	353	488	4.62e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000214995

Predicted Effect

probably damaging
Transcript: ENSMUST00000216798
AA Change: Y83H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Lipc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lipc	APN	9	70820437	missense	possibly damaging	0.56
IGL02431:Lipc	APN	9	70934468	intron	probably benign
Immunobolic	UTSW	9	70823386	missense	probably damaging	1.00
R0112:Lipc	UTSW	9	70820427	missense	probably damaging	1.00
R0114:Lipc	UTSW	9	70803781	missense	probably damaging	0.99
R0545:Lipc	UTSW	9	70812705	missense	probably damaging	1.00
R1051:Lipc	UTSW	9	70802116	missense	probably benign	0.00
R1069:Lipc	UTSW	9	70823537	missense	probably benign	0.03
R1350:Lipc	UTSW	9	70798367	missense	probably benign	0.00
R1742:Lipc	UTSW	9	70820529	missense	probably damaging	1.00
R2145:Lipc	UTSW	9	70934535	missense	possibly damaging	0.94
R3880:Lipc	UTSW	9	70820518	missense	probably damaging	0.99
R4360:Lipc	UTSW	9	70852582	intron	probably benign
R4999:Lipc	UTSW	9	70816731	missense	probably benign	0.00
R5159:Lipc	UTSW	9	70812910	missense	probably benign	0.03
R5197:Lipc	UTSW	9	70798391	missense	probably benign	0.11
R5458:Lipc	UTSW	9	70852582	intron	probably benign
R5710:Lipc	UTSW	9	70812697	missense	probably benign	0.30
R6645:Lipc	UTSW	9	70803748	missense	probably damaging	1.00
R6749:Lipc	UTSW	9	70823386	missense	probably damaging	1.00
R6849:Lipc	UTSW	9	70818847	critical splice donor site	probably null
R7011:Lipc	UTSW	9	70818954	missense	probably benign	0.09
R7346:Lipc	UTSW	9	70812747	missense	probably damaging	1.00
R7426:Lipc	UTSW	9	70802168	missense	probably benign	0.21
R7830:Lipc	UTSW	9	70812901	missense	probably damaging	1.00
R8269:Lipc	UTSW	9	70820373	missense	probably damaging	1.00
X0054:Lipc	UTSW	9	70812748	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACAGAAGGCGTGTTAGG -3'
(R):5'- CCAAGATGACAGCCAGTGAG -3'

Sequencing Primer
(F):5'- GAGTGCTCAGTGTTACCCCTCAG -3'
(R):5'- TGAGGTGACAAGCCAGTTTCC -3'

Posted On

2019-10-24