Mutagenetix > Incidental Mutations

Incidental Mutation 'R7587:Lipc'

587217

Institutional Source

Beutler Lab

Gene Symbol

Lipc

Ensembl Gene

ENSMUSG00000032207

Gene Name

lipase, hepatic

Synonyms

Hpl, HL

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70798128-70952226 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70818924 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 168 (Y168H)

Ref Sequence

ENSEMBL: ENSMUSP00000034731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000214995] [ENSMUST00000216798]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034731
AA Change: Y168H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: Y168H

Domain	Start	End	E-Value	Type
Pfam:Lipase	14	350	1.1e-136	PFAM
LH2	353	488	4.62e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000214995

Predicted Effect

probably damaging
Transcript: ENSMUST00000216798
AA Change: Y83H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Lipc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lipc	APN	9	70820437	missense	possibly damaging	0.56
IGL02431:Lipc	APN	9	70934468	intron	probably benign
Immunobolic	UTSW	9	70823386	missense	probably damaging	1.00
R0112:Lipc	UTSW	9	70820427	missense	probably damaging	1.00
R0114:Lipc	UTSW	9	70803781	missense	probably damaging	0.99
R0545:Lipc	UTSW	9	70812705	missense	probably damaging	1.00
R1051:Lipc	UTSW	9	70802116	missense	probably benign	0.00
R1069:Lipc	UTSW	9	70823537	missense	probably benign	0.03
R1350:Lipc	UTSW	9	70798367	missense	probably benign	0.00
R1742:Lipc	UTSW	9	70820529	missense	probably damaging	1.00
R2145:Lipc	UTSW	9	70934535	missense	possibly damaging	0.94
R3880:Lipc	UTSW	9	70820518	missense	probably damaging	0.99
R4360:Lipc	UTSW	9	70852582	intron	probably benign
R4999:Lipc	UTSW	9	70816731	missense	probably benign	0.00
R5159:Lipc	UTSW	9	70812910	missense	probably benign	0.03
R5197:Lipc	UTSW	9	70798391	missense	probably benign	0.11
R5458:Lipc	UTSW	9	70852582	intron	probably benign
R5710:Lipc	UTSW	9	70812697	missense	probably benign	0.30
R6645:Lipc	UTSW	9	70803748	missense	probably damaging	1.00
R6749:Lipc	UTSW	9	70823386	missense	probably damaging	1.00
R6849:Lipc	UTSW	9	70818847	critical splice donor site	probably null
R7011:Lipc	UTSW	9	70818954	missense	probably benign	0.09
R7346:Lipc	UTSW	9	70812747	missense	probably damaging	1.00
R7426:Lipc	UTSW	9	70802168	missense	probably benign	0.21
R7830:Lipc	UTSW	9	70812901	missense	probably damaging	1.00
X0054:Lipc	UTSW	9	70812748	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACAGAAGGCGTGTTAGG -3'
(R):5'- CCAAGATGACAGCCAGTGAG -3'

Sequencing Primer
(F):5'- GAGTGCTCAGTGTTACCCCTCAG -3'
(R):5'- TGAGGTGACAAGCCAGTTTCC -3'

Posted On

2019-10-24