Incidental Mutation 'R7587:Unc5b'
ID587219
Institutional Source Beutler Lab
Gene Symbol Unc5b
Ensembl Gene ENSMUSG00000020099
Gene Nameunc-5 netrin receptor B
SynonymsUnc5h2, D10Bwg0792e, 6330415E02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location60762593-60831581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60783120 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 81 (C81Y)
Ref Sequence ENSEMBL: ENSMUSP00000077080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077925] [ENSMUST00000218637]
PDB Structure
Crystal structure of the UNC5H2 death domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000077925
AA Change: C81Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: C81Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG_like 54 149 1.71e2 SMART
IGc2 165 232 2.58e-6 SMART
TSP1 249 300 8.21e-15 SMART
TSP1 305 354 2.61e-8 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
ZU5 541 644 1.91e-56 SMART
DEATH 852 943 5.55e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218637
AA Change: C81Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Unc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Unc5b APN 10 60783216 missense possibly damaging 0.73
IGL00578:Unc5b APN 10 60767055 missense probably damaging 1.00
IGL01895:Unc5b APN 10 60767085 missense probably damaging 1.00
IGL01955:Unc5b APN 10 60778255 missense probably benign 0.30
IGL01980:Unc5b APN 10 60780187 missense probably damaging 1.00
IGL02277:Unc5b APN 10 60774742 missense probably benign
LCD18:Unc5b UTSW 10 60786171 intron probably benign
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0026:Unc5b UTSW 10 60774592 missense possibly damaging 0.86
R0147:Unc5b UTSW 10 60772297 missense probably damaging 0.96
R0305:Unc5b UTSW 10 60779658 splice site probably benign
R0306:Unc5b UTSW 10 60779658 splice site probably benign
R0373:Unc5b UTSW 10 60778940 missense possibly damaging 0.78
R0662:Unc5b UTSW 10 60772583 missense possibly damaging 0.68
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1512:Unc5b UTSW 10 60831475 unclassified probably benign
R1532:Unc5b UTSW 10 60769232 missense probably damaging 0.99
R1916:Unc5b UTSW 10 60778248 missense probably damaging 1.00
R1931:Unc5b UTSW 10 60772569 missense probably benign 0.30
R1954:Unc5b UTSW 10 60769265 splice site probably benign
R2350:Unc5b UTSW 10 60778200 missense probably benign 0.04
R3419:Unc5b UTSW 10 60778814 missense probably damaging 1.00
R4116:Unc5b UTSW 10 60774700 missense probably damaging 0.99
R4258:Unc5b UTSW 10 60765371 missense probably damaging 0.99
R4329:Unc5b UTSW 10 60783190 missense probably damaging 1.00
R4605:Unc5b UTSW 10 60774403 missense probably benign 0.01
R4828:Unc5b UTSW 10 60772348 missense possibly damaging 0.90
R5134:Unc5b UTSW 10 60775100 missense probably benign 0.09
R5190:Unc5b UTSW 10 60772293 missense probably benign 0.04
R5240:Unc5b UTSW 10 60774640 missense probably damaging 0.99
R5342:Unc5b UTSW 10 60778267 nonsense probably null
R5522:Unc5b UTSW 10 60778195 missense possibly damaging 0.91
R5694:Unc5b UTSW 10 60773747 missense probably benign 0.02
R5822:Unc5b UTSW 10 60772527 missense possibly damaging 0.71
R5909:Unc5b UTSW 10 60772359 missense probably damaging 1.00
R6007:Unc5b UTSW 10 60765360 missense probably damaging 1.00
R6115:Unc5b UTSW 10 60777546 missense probably benign 0.33
R6182:Unc5b UTSW 10 60765236 missense probably damaging 1.00
R6187:Unc5b UTSW 10 60772224 missense probably damaging 1.00
R6294:Unc5b UTSW 10 60778331 missense possibly damaging 0.82
R6319:Unc5b UTSW 10 60778801 missense probably damaging 1.00
R6366:Unc5b UTSW 10 60778312 missense probably benign
R6532:Unc5b UTSW 10 60778828 missense possibly damaging 0.95
R6827:Unc5b UTSW 10 60780232 missense probably benign
R6912:Unc5b UTSW 10 60831092 missense probably benign
R7032:Unc5b UTSW 10 60778808 missense probably damaging 0.99
R7082:Unc5b UTSW 10 60775088 missense probably damaging 0.98
R7089:Unc5b UTSW 10 60777486 missense probably damaging 1.00
R7270:Unc5b UTSW 10 60772223 nonsense probably null
R7716:Unc5b UTSW 10 60777438 missense probably damaging 1.00
R7750:Unc5b UTSW 10 60775044 missense probably benign 0.00
R7810:Unc5b UTSW 10 60765241 missense probably benign
R7895:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
R7978:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
RF019:Unc5b UTSW 10 60783183 missense probably damaging 1.00
X0027:Unc5b UTSW 10 60777459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAAGACTGGCCAACTGTG -3'
(R):5'- AGGTGTTCATGGTACTCTCCC -3'

Sequencing Primer
(F):5'- CTGTGTGGCAGGGTGGG -3'
(R):5'- CTCCACAGGCGTTGACTCTG -3'
Posted On2019-10-24