Incidental Mutation 'R7587:Dio2'
ID 587224
Institutional Source Beutler Lab
Gene Symbol Dio2
Ensembl Gene ENSMUSG00000007682
Gene Name deiodinase, iodothyronine, type II
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 90724552-90738438 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90729560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000081013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082432]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082432
AA Change: V218A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081013
Gene: ENSMUSG00000007682
AA Change: V218A

DomainStartEndE-ValueType
Pfam:T4_deiodinase 4 259 1.6e-119 PFAM
Pfam:AhpC-TSA 78 237 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is highly expressed in brain, placenta and mammary gland. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. Knockout studies in mice suggest that this gene may play an important role in brown adipose tissue lipogenesis, auditory function, and bone formation. This protein is a selenoprotein containing the rare selenocysteine (Sec) amino acid at its active site, and may contain additional Sec residues. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display elevated thyroxine (T4) and thyroid-stimulating hormone levels, changes in the metabolism and excretion of iodothyronines, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Kdm3b A G 18: 34,797,027 probably null Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lpp A T 16: 24,762,279 probably null Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Ncbp3 T C 11: 73,066,765 probably null Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Dio2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02665:Dio2 APN 12 90729653 missense possibly damaging 0.87
IGL02832:Dio2 APN 12 90729404 utr 3 prime probably benign
R0139:Dio2 UTSW 12 90729843 missense probably damaging 1.00
R0620:Dio2 UTSW 12 90738071 missense probably benign 0.24
R0908:Dio2 UTSW 12 90729648 missense probably damaging 1.00
R1106:Dio2 UTSW 12 90738211 missense probably damaging 1.00
R1799:Dio2 UTSW 12 90729906 missense probably benign 0.00
R2099:Dio2 UTSW 12 90729823 makesense probably null
R2101:Dio2 UTSW 12 90729823 makesense probably null
R4615:Dio2 UTSW 12 90729821 missense probably damaging 1.00
R6560:Dio2 UTSW 12 90729833 nonsense probably null
R6960:Dio2 UTSW 12 90729897 missense probably damaging 0.97
R9367:Dio2 UTSW 12 90729813 missense probably benign 0.07
Z1177:Dio2 UTSW 12 90729912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGGTGAGGCAATGGGATTC -3'
(R):5'- GGTATACATTGATGAGGCTCACC -3'

Sequencing Primer
(F):5'- ATAGATTCAGTTCAGTTCTCAACTTC -3'
(R):5'- ATTGATGAGGCTCACCCTTCGG -3'
Posted On 2019-10-24