Incidental Mutation 'R7587:Dio2'
ID 587224
Institutional Source Beutler Lab
Gene Symbol Dio2
Ensembl Gene ENSMUSG00000007682
Gene Name deiodinase, iodothyronine, type II
Synonyms
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 90691326-90705812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90696334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000081013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082432]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082432
AA Change: V218A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081013
Gene: ENSMUSG00000007682
AA Change: V218A

DomainStartEndE-ValueType
Pfam:T4_deiodinase 4 259 1.6e-119 PFAM
Pfam:AhpC-TSA 78 237 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is highly expressed in brain, placenta and mammary gland. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. Knockout studies in mice suggest that this gene may play an important role in brown adipose tissue lipogenesis, auditory function, and bone formation. This protein is a selenoprotein containing the rare selenocysteine (Sec) amino acid at its active site, and may contain additional Sec residues. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display elevated thyroxine (T4) and thyroid-stimulating hormone levels, changes in the metabolism and excretion of iodothyronines, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Dio2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02665:Dio2 APN 12 90,696,427 (GRCm39) missense possibly damaging 0.87
IGL02832:Dio2 APN 12 90,696,178 (GRCm39) utr 3 prime probably benign
R0139:Dio2 UTSW 12 90,696,617 (GRCm39) missense probably damaging 1.00
R0620:Dio2 UTSW 12 90,704,845 (GRCm39) missense probably benign 0.24
R0908:Dio2 UTSW 12 90,696,422 (GRCm39) missense probably damaging 1.00
R1106:Dio2 UTSW 12 90,704,985 (GRCm39) missense probably damaging 1.00
R1799:Dio2 UTSW 12 90,696,680 (GRCm39) missense probably benign 0.00
R2099:Dio2 UTSW 12 90,696,597 (GRCm39) makesense probably null
R2101:Dio2 UTSW 12 90,696,597 (GRCm39) makesense probably null
R4615:Dio2 UTSW 12 90,696,595 (GRCm39) missense probably damaging 1.00
R6560:Dio2 UTSW 12 90,696,607 (GRCm39) nonsense probably null
R6960:Dio2 UTSW 12 90,696,671 (GRCm39) missense probably damaging 0.97
R9367:Dio2 UTSW 12 90,696,587 (GRCm39) missense probably benign 0.07
Z1177:Dio2 UTSW 12 90,696,686 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGGTGAGGCAATGGGATTC -3'
(R):5'- GGTATACATTGATGAGGCTCACC -3'

Sequencing Primer
(F):5'- ATAGATTCAGTTCAGTTCTCAACTTC -3'
(R):5'- ATTGATGAGGCTCACCCTTCGG -3'
Posted On 2019-10-24