Incidental Mutation 'R7587:Mylk'
ID 587232
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34742887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1133 (E1133G)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: E1133G

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: E1133G

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGGTCCCTGAAACCTGTAAC -3'
(R):5'- TTGACAGTGACCCATGGATG -3'

Sequencing Primer
(F):5'- CGCACAACCTGCTGAGC -3'
(R):5'- GGGCTTCCCATCTTCCCTAC -3'
Posted On 2019-10-24