Incidental Mutation 'R7587:Ppt2'
ID587236
Institutional Source Beutler Lab
Gene Symbol Ppt2
Ensembl Gene ENSMUSG00000015474
Gene Namepalmitoyl-protein thioesterase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34616662-34628510 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34626803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015620] [ENSMUST00000064953] [ENSMUST00000166040] [ENSMUST00000167097] [ENSMUST00000168391] [ENSMUST00000169067] [ENSMUST00000169287] [ENSMUST00000170345] [ENSMUST00000171121] [ENSMUST00000171376]
Predicted Effect probably benign
Transcript: ENSMUST00000015620
SMART Domains Protein: ENSMUSP00000015620
Gene: ENSMUSG00000015476

DomainStartEndE-ValueType
low complexity region 17 38 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
low complexity region 57 79 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
Pfam:CD225 214 286 3.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000064953
SMART Domains Protein: ENSMUSP00000068071
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166040
SMART Domains Protein: ENSMUSP00000132006
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 289 9e-19 PFAM
Pfam:Abhydrolase_1 37 173 9e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167097
SMART Domains Protein: ENSMUSP00000125937
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 236 7.7e-12 PFAM
Pfam:Abhydrolase_6 39 236 2.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168391
SMART Domains Protein: ENSMUSP00000132339
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169067
SMART Domains Protein: ENSMUSP00000127372
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169287
SMART Domains Protein: ENSMUSP00000129421
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
PDB:1PJA|A 1 102 2e-42 PDB
SCOP:d1fj2a_ 29 91 7e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169969
SMART Domains Protein: ENSMUSP00000127726
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Abhydrolase_1 18 139 9e-8 PFAM
Pfam:Palm_thioest 116 234 1.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170345
SMART Domains Protein: ENSMUSP00000127707
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 33 203 1.6e-9 PFAM
Pfam:Abhydrolase_6 39 201 2.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171121
SMART Domains Protein: ENSMUSP00000127745
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171376
SMART Domains Protein: ENSMUSP00000131243
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants show autofluorescent storage material in brain, abnormal clasping behavior, spasticity, ataxia and increased adult mortality. In addition, lipofuscin pigments in pancreas, bone marrow histiocytosis and splenomegaly are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Kdm3b A G 18: 34,797,027 probably null Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lpp A T 16: 24,762,279 probably null Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Ncbp3 T C 11: 73,066,765 probably null Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Ppt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Ppt2 APN 17 34625754 splice site probably benign
R0180:Ppt2 UTSW 17 34626503 missense probably damaging 1.00
R0685:Ppt2 UTSW 17 34626572 missense probably damaging 0.98
R1498:Ppt2 UTSW 17 34623101 missense probably benign 0.00
R2058:Ppt2 UTSW 17 34622844 splice site probably benign
R2059:Ppt2 UTSW 17 34622844 splice site probably benign
R3919:Ppt2 UTSW 17 34622923 missense probably damaging 1.00
R4622:Ppt2 UTSW 17 34625901 missense probably benign 0.16
R5582:Ppt2 UTSW 17 34617399 missense probably damaging 0.99
R5638:Ppt2 UTSW 17 34625849 missense probably benign 0.37
R6502:Ppt2 UTSW 17 34625920 missense probably damaging 1.00
R7065:Ppt2 UTSW 17 34622855 missense probably damaging 1.00
R7523:Ppt2 UTSW 17 34626803 critical splice donor site probably null
R7782:Ppt2 UTSW 17 34625712 missense probably benign 0.05
R7910:Ppt2 UTSW 17 34627326 splice site probably null
R8708:Ppt2 UTSW 17 34625639 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGGCACTAGGTTGGACAAAG -3'
(R):5'- TCATACGGACCAGGAGTAGG -3'

Sequencing Primer
(F):5'- GCACTAGGTTGGACAAAGTGTATTC -3'
(R):5'- CCTTCTCAGGTGGGAGCATG -3'
Posted On2019-10-24