Mutagenetix > Incidental Mutations

Incidental Mutation 'R7587:Vps13a'

587239

Institutional Source

Beutler Lab

Gene Symbol

Vps13a

Ensembl Gene

ENSMUSG00000046230

Gene Name

vacuolar protein sorting 13A

Synonyms

4930516E05Rik, 4930543C13Rik, D330038K10Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16615366-16780933 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 16703789 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1041 (T1041M)

Ref Sequence

ENSEMBL: ENSMUSP00000068716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]

Predicted Effect

probably benign
Transcript: ENSMUST00000068156
AA Change: T1041M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: T1041M

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	5.4e-38	PFAM
Pfam:VPS13	139	371	3.7e-64	PFAM
low complexity region	553	563	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	567	791	1.4e-69	PFAM
Pfam:VPS13_mid_rpt	1138	1329	2e-10	PFAM
low complexity region	1367	1377	N/A	INTRINSIC
Blast:INB	1575	1855	1e-149	BLAST
Pfam:SHR-BD	2200	2449	1.3e-35	PFAM
low complexity region	2510	2521	N/A	INTRINSIC
low complexity region	2632	2648	N/A	INTRINSIC
low complexity region	2719	2731	N/A	INTRINSIC
Pfam:VPS13_C	2755	2935	8.9e-66	PFAM
Pfam:ATG_C	2938	3029	1.6e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224149
AA Change: T1041M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het

Other mutations in Vps13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Vps13a	APN	19	16752175	missense	probably damaging	0.98
IGL00537:Vps13a	APN	19	16680045	missense	probably benign	0.03
IGL00562:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00563:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00579:Vps13a	APN	19	16707362	missense	probably benign	0.29
IGL00662:Vps13a	APN	19	16704540	missense	probably damaging	0.96
IGL00667:Vps13a	APN	19	16759676	missense	probably damaging	1.00
IGL01102:Vps13a	APN	19	16651417	critical splice donor site	probably null
IGL01139:Vps13a	APN	19	16640625	missense	probably damaging	0.99
IGL01142:Vps13a	APN	19	16687115	missense	possibly damaging	0.86
IGL01361:Vps13a	APN	19	16743007	missense	probably damaging	1.00
IGL01386:Vps13a	APN	19	16701152	missense	possibly damaging	0.87
IGL01593:Vps13a	APN	19	16762181	missense	probably damaging	0.98
IGL01700:Vps13a	APN	19	16744857	nonsense	probably null
IGL01767:Vps13a	APN	19	16663894	missense	probably damaging	1.00
IGL01782:Vps13a	APN	19	16754337	missense	probably damaging	0.98
IGL01808:Vps13a	APN	19	16710286	missense	probably damaging	1.00
IGL01812:Vps13a	APN	19	16715060	missense	probably benign
IGL01829:Vps13a	APN	19	16619443	missense	probably benign	0.01
IGL01893:Vps13a	APN	19	16663775	missense	probably damaging	1.00
IGL02222:Vps13a	APN	19	16682175	missense	probably benign	0.06
IGL02295:Vps13a	APN	19	16715042	splice site	probably benign
IGL02465:Vps13a	APN	19	16710941	missense	probably benign	0.11
IGL02492:Vps13a	APN	19	16647637	missense	probably damaging	1.00
IGL02581:Vps13a	APN	19	16655322	missense	probably benign	0.41
IGL02633:Vps13a	APN	19	16720408	missense	possibly damaging	0.82
IGL02641:Vps13a	APN	19	16698821	missense	probably benign	0.01
IGL02659:Vps13a	APN	19	16652699	missense	probably damaging	1.00
IGL02827:Vps13a	APN	19	16641634	missense	possibly damaging	0.91
IGL02943:Vps13a	APN	19	16663886	missense	probably damaging	1.00
IGL03057:Vps13a	APN	19	16668694	missense	probably damaging	1.00
IGL03077:Vps13a	APN	19	16710882	missense	probably benign
IGL03184:Vps13a	APN	19	16654370	missense	probably benign	0.00
eggs	UTSW	19	16701165	missense	probably damaging	1.00
excambio	UTSW	19	16745947	splice site	probably null
Faster	UTSW	19	16619485	missense	probably damaging	1.00
Ham	UTSW	19	16677969	missense	probably benign	0.08
interchange	UTSW	19	16668690	missense	probably damaging	1.00
PIT4377001:Vps13a	UTSW	19	16740901	missense	probably damaging	1.00
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0048:Vps13a	UTSW	19	16676140	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0107:Vps13a	UTSW	19	16691824	missense	probably benign	0.03
R0135:Vps13a	UTSW	19	16780765	missense	probably damaging	1.00
R0138:Vps13a	UTSW	19	16660499	missense	possibly damaging	0.95
R0346:Vps13a	UTSW	19	16677969	missense	probably benign	0.08
R0359:Vps13a	UTSW	19	16641577	missense	probably damaging	0.99
R0530:Vps13a	UTSW	19	16655206	splice site	probably benign
R0541:Vps13a	UTSW	19	16704577	missense	probably benign	0.00
R0614:Vps13a	UTSW	19	16652694	missense	probably damaging	1.00
R0685:Vps13a	UTSW	19	16780741	missense	probably damaging	1.00
R0801:Vps13a	UTSW	19	16686656	splice site	probably benign
R0835:Vps13a	UTSW	19	16734882	splice site	probably null
R0848:Vps13a	UTSW	19	16698897	missense	probably damaging	1.00
R1114:Vps13a	UTSW	19	16750151	missense	probably benign	0.41
R1205:Vps13a	UTSW	19	16640541	missense	probably damaging	1.00
R1365:Vps13a	UTSW	19	16619446	missense	probably damaging	1.00
R1445:Vps13a	UTSW	19	16701238	nonsense	probably null
R1451:Vps13a	UTSW	19	16710864	missense	probably benign	0.01
R1479:Vps13a	UTSW	19	16750114	splice site	probably benign
R1533:Vps13a	UTSW	19	16701130	nonsense	probably null
R1600:Vps13a	UTSW	19	16666272	missense	probably benign	0.01
R1870:Vps13a	UTSW	19	16759952	missense	probably damaging	1.00
R1871:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R1959:Vps13a	UTSW	19	16677938	missense	possibly damaging	0.49
R1960:Vps13a	UTSW	19	16725631	missense	probably damaging	1.00
R1993:Vps13a	UTSW	19	16722458	missense	probably benign	0.07
R2257:Vps13a	UTSW	19	16682174	missense	possibly damaging	0.85
R2276:Vps13a	UTSW	19	16710426	missense	possibly damaging	0.47
R2326:Vps13a	UTSW	19	16743057	missense	possibly damaging	0.71
R2338:Vps13a	UTSW	19	16720453	missense	probably damaging	1.00
R2359:Vps13a	UTSW	19	16652679	splice site	probably benign
R2421:Vps13a	UTSW	19	16759671	missense	probably benign
R2847:Vps13a	UTSW	19	16703599	missense	probably damaging	0.98
R3081:Vps13a	UTSW	19	16664737	missense	probably benign	0.02
R3522:Vps13a	UTSW	19	16766493	splice site	probably benign
R3613:Vps13a	UTSW	19	16685402	missense	probably damaging	1.00
R3797:Vps13a	UTSW	19	16745947	splice site	probably null
R3874:Vps13a	UTSW	19	16744953	missense	probably benign	0.01
R4032:Vps13a	UTSW	19	16616899	missense	probably damaging	1.00
R4111:Vps13a	UTSW	19	16640628	missense	probably damaging	1.00
R4383:Vps13a	UTSW	19	16701165	missense	probably damaging	1.00
R4504:Vps13a	UTSW	19	16695502	missense	possibly damaging	0.93
R4578:Vps13a	UTSW	19	16682110	missense	probably damaging	0.98
R4587:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4588:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4605:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4714:Vps13a	UTSW	19	16749856	missense	probably benign	0.01
R4756:Vps13a	UTSW	19	16655216	missense	probably benign	0.01
R4831:Vps13a	UTSW	19	16677992	missense	probably benign	0.04
R5068:Vps13a	UTSW	19	16746058	missense	probably benign	0.01
R5070:Vps13a	UTSW	19	16654484	missense	probably benign
R5082:Vps13a	UTSW	19	16744893	missense	probably damaging	1.00
R5182:Vps13a	UTSW	19	16695499	missense	possibly damaging	0.81
R5189:Vps13a	UTSW	19	16685315	missense	probably damaging	1.00
R5283:Vps13a	UTSW	19	16677970	missense	probably damaging	0.96
R5294:Vps13a	UTSW	19	16641667	missense	probably damaging	1.00
R5304:Vps13a	UTSW	19	16710387	missense	possibly damaging	0.78
R5554:Vps13a	UTSW	19	16722411	missense	probably damaging	1.00
R5592:Vps13a	UTSW	19	16725571	missense	probably damaging	1.00
R5611:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R5665:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R5671:Vps13a	UTSW	19	16715100	missense	probably benign	0.03
R5684:Vps13a	UTSW	19	16699045	missense	probably benign	0.00
R5767:Vps13a	UTSW	19	16664564	missense	probably damaging	1.00
R5810:Vps13a	UTSW	19	16666324	missense	probably benign	0.00
R5866:Vps13a	UTSW	19	16680023	missense	probably benign	0.04
R5886:Vps13a	UTSW	19	16664562	missense	probably benign	0.01
R5933:Vps13a	UTSW	19	16660530	missense	probably benign	0.34
R5965:Vps13a	UTSW	19	16619028	splice site	probably null
R6259:Vps13a	UTSW	19	16687170	nonsense	probably null
R6346:Vps13a	UTSW	19	16682214	missense	possibly damaging	0.94
R6459:Vps13a	UTSW	19	16664018	missense	possibly damaging	0.56
R6485:Vps13a	UTSW	19	16680050	missense	probably damaging	0.99
R6520:Vps13a	UTSW	19	16725579	missense	probably damaging	1.00
R6644:Vps13a	UTSW	19	16744919	missense	possibly damaging	0.90
R6932:Vps13a	UTSW	19	16678075	missense	probably benign	0.01
R6934:Vps13a	UTSW	19	16676194	missense	probably damaging	1.00
R6951:Vps13a	UTSW	19	16723740	missense	probably benign	0.00
R7027:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R7126:Vps13a	UTSW	19	16710879	missense	probably benign
R7206:Vps13a	UTSW	19	16754298	missense	probably damaging	1.00
R7248:Vps13a	UTSW	19	16678042	missense	probably benign	0.25
R7252:Vps13a	UTSW	19	16661064	missense	probably benign	0.00
R7255:Vps13a	UTSW	19	16654339	critical splice donor site	probably null
R7382:Vps13a	UTSW	19	16619485	missense	probably damaging	1.00
R7422:Vps13a	UTSW	19	16750173	missense	probably damaging	1.00
R7425:Vps13a	UTSW	19	16723702	missense	probably benign	0.13
R7523:Vps13a	UTSW	19	16703789	missense	probably benign
R7586:Vps13a	UTSW	19	16647598	missense	probably benign	0.08
R7593:Vps13a	UTSW	19	16725663	missense	probably damaging	1.00
R7637:Vps13a	UTSW	19	16750149	missense	probably benign	0.02
R7763:Vps13a	UTSW	19	16746000	missense	possibly damaging	0.95
R7813:Vps13a	UTSW	19	16651456	missense	possibly damaging	0.81
R7815:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R7861:Vps13a	UTSW	19	16655304	missense	probably damaging	1.00
R7909:Vps13a	UTSW	19	16720430	nonsense	probably null
R7939:Vps13a	UTSW	19	16740791	missense	possibly damaging	0.94
R8108:Vps13a	UTSW	19	16640787	missense	probably damaging	1.00
R8123:Vps13a	UTSW	19	16647702	missense	probably benign	0.01
R8134:Vps13a	UTSW	19	16654354	missense	possibly damaging	0.71
R8168:Vps13a	UTSW	19	16749548	missense	probably benign	0.09
R8272:Vps13a	UTSW	19	16749845	critical splice donor site	probably null
R8293:Vps13a	UTSW	19	16668605	missense	possibly damaging	0.81
R8303:Vps13a	UTSW	19	16616906	missense	probably benign	0.00
R8383:Vps13a	UTSW	19	16723705	missense	possibly damaging	0.83
R8386:Vps13a	UTSW	19	16701119	critical splice donor site	probably null
R8433:Vps13a	UTSW	19	16741236	missense	possibly damaging	0.56
R8436:Vps13a	UTSW	19	16740793	missense	probably benign	0.10
R8450:Vps13a	UTSW	19	16654507	splice site	probably null
R8476:Vps13a	UTSW	19	16722457	missense	possibly damaging	0.60
R8501:Vps13a	UTSW	19	16682120	missense	probably benign	0.39
R8552:Vps13a	UTSW	19	16754320	missense	probably damaging	0.99
R8680:Vps13a	UTSW	19	16645906	missense	possibly damaging	0.84
R8784:Vps13a	UTSW	19	16664789	missense	probably damaging	1.00
R8871:Vps13a	UTSW	19	16663822	missense	probably damaging	1.00
X0061:Vps13a	UTSW	19	16645868	missense	probably benign	0.40
X0066:Vps13a	UTSW	19	16742553	missense	probably benign	0.33
Z1177:Vps13a	UTSW	19	16699113	critical splice acceptor site	probably null
Z31818:Vps13a	UTSW	19	16780754	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCTCAGAATCAAGCCCTAGGG -3'
(R):5'- CACCTCTAGGACCATTCTTGG -3'

Sequencing Primer
(F):5'- CCCTAGGGGAATGAAACAATAA -3'
(R):5'- GACCATTCTTGGGCCTGC -3'

Posted On

2019-10-24