Incidental Mutation 'R7588:Mapk8ip1'
ID587244
Institutional Source Beutler Lab
Gene Symbol Mapk8ip1
Ensembl Gene ENSMUSG00000027223
Gene Namemitogen-activated protein kinase 8 interacting protein 1
SynonymsMAPK8IP1, IB1, Jip1, mjip-2a, Prkm8ip, Skip, JIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location92383676-92401263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92386639 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 446 (D446V)
Ref Sequence ENSEMBL: ENSMUSP00000050773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050312] [ENSMUST00000054316] [ENSMUST00000111279] [ENSMUST00000111280] [ENSMUST00000191292]
PDB Structure
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Structural basis for the selective inhibition of JNK1 by the scaffolding protein JIP1 and SP600125 [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform [X-RAY DIFFRACTION]
Crystal Structure of JNK1-alpha1 isoform complex with a biaryl tetrazol (A-82118) [X-RAY DIFFRACTION]
Structural and functional analysis of quercetagetin, a natural JNK1 inhibitor [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050312
AA Change: D446V

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050773
Gene: ENSMUSG00000027223
AA Change: D446V

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
SH3 487 544 2.62e-11 SMART
PTB 558 700 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054316
SMART Domains Protein: ENSMUSP00000051464
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
Pfam:DUF4733 4 97 7.7e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111279
AA Change: D437V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106910
Gene: ENSMUSG00000027223
AA Change: D437V

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 62 78 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
low complexity region 233 245 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
SH3 478 535 2.62e-11 SMART
PTB 549 691 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111280
SMART Domains Protein: ENSMUSP00000106911
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191292
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutation of this gene results in a decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Mapk8ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mapk8ip1 APN 2 92385188 missense probably benign 0.06
IGL01538:Mapk8ip1 APN 2 92388974 critical splice donor site probably null
IGL02089:Mapk8ip1 APN 2 92385875 missense probably damaging 1.00
IGL02177:Mapk8ip1 APN 2 92386747 missense probably damaging 1.00
IGL03032:Mapk8ip1 APN 2 92386613 missense probably damaging 1.00
IGL03180:Mapk8ip1 APN 2 92386912 missense possibly damaging 0.91
R0243:Mapk8ip1 UTSW 2 92385944 missense probably damaging 1.00
R0483:Mapk8ip1 UTSW 2 92385976 splice site probably null
R0515:Mapk8ip1 UTSW 2 92387356 missense possibly damaging 0.71
R2016:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R2017:Mapk8ip1 UTSW 2 92391034 critical splice donor site probably null
R5141:Mapk8ip1 UTSW 2 92386765 missense probably damaging 1.00
R5858:Mapk8ip1 UTSW 2 92384972 missense probably damaging 1.00
R6194:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6243:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6244:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6245:Mapk8ip1 UTSW 2 92389244 missense probably damaging 0.98
R6984:Mapk8ip1 UTSW 2 92386727 missense probably damaging 1.00
R7471:Mapk8ip1 UTSW 2 92389144 missense probably benign
R7810:Mapk8ip1 UTSW 2 92389151 missense probably benign 0.05
R8021:Mapk8ip1 UTSW 2 92386415 missense possibly damaging 0.91
X0023:Mapk8ip1 UTSW 2 92386601 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AAAGGACTCAGCACCTGTGG -3'
(R):5'- ATGCCCAGCTTGAGTTGGTG -3'

Sequencing Primer
(F):5'- CACCTGTGGGAAGGCAATAGTTTG -3'
(R):5'- CAGCTTGAGTTGGTGAGCCTG -3'
Posted On2019-10-24