Incidental Mutation 'R7588:Kcnk15'
ID587246
Institutional Source Beutler Lab
Gene Symbol Kcnk15
Ensembl Gene ENSMUSG00000035238
Gene Namepotassium channel, subfamily K, member 15
SynonymsKCNK11, KT3.3, KCNK14, TASK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location163853651-163859746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163858306 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 155 (V155A)
Ref Sequence ENSEMBL: ENSMUSP00000048326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044734] [ENSMUST00000044798] [ENSMUST00000109396]
Predicted Effect probably benign
Transcript: ENSMUST00000044734
SMART Domains Protein: ENSMUSP00000045637
Gene: ENSMUSG00000035226

DomainStartEndE-ValueType
C2 129 232 1.42e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000044798
AA Change: V155A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048326
Gene: ENSMUSG00000035238
AA Change: V155A

DomainStartEndE-ValueType
Pfam:Ion_trans_2 78 153 1.2e-20 PFAM
Pfam:Ion_trans_2 184 267 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109396
AA Change: V136A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105023
Gene: ENSMUSG00000035238
AA Change: V136A

DomainStartEndE-ValueType
Pfam:Ion_trans_2 62 134 5.2e-21 PFAM
Pfam:Ion_trans_2 165 248 1.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Kcnk15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Kcnk15 UTSW 2 163858323 missense probably benign 0.00
R0443:Kcnk15 UTSW 2 163858323 missense probably benign 0.00
R1472:Kcnk15 UTSW 2 163858207 missense probably damaging 1.00
R3722:Kcnk15 UTSW 2 163858294 missense probably damaging 1.00
R3732:Kcnk15 UTSW 2 163853813 missense probably benign 0.08
R3732:Kcnk15 UTSW 2 163853813 missense probably benign 0.08
R4403:Kcnk15 UTSW 2 163858618 missense probably damaging 1.00
R7090:Kcnk15 UTSW 2 163858717 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCAGAGTGCAGGAATGGC -3'
(R):5'- TTGAGGAAGGCACCGATGAC -3'

Sequencing Primer
(F):5'- CAGGAATGGCATAGGTTTGGC -3'
(R):5'- AAGTCGCCGAAGCCTATG -3'
Posted On2019-10-24