Incidental Mutation 'R7588:Pcdh7'
ID587250
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Nameprotocadherin 7
SynonymsBH-protocadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location57717967-58133230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57719904 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 267 (D267G)
Ref Sequence ENSEMBL: ENSMUSP00000142319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
Predicted Effect probably damaging
Transcript: ENSMUST00000068110
AA Change: D267G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: D267G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108
AA Change: D267G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191837
AA Change: D267G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108
AA Change: D267G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192048
Predicted Effect probably benign
Transcript: ENSMUST00000192287
Predicted Effect probably benign
Transcript: ENSMUST00000195156
Predicted Effect probably benign
Transcript: ENSMUST00000199310
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57721464 missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57720131 missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57720464 missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58129224 missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57720204 missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57720765 missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57720422 missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58129255 missense probably benign
IGL02014:Pcdh7 APN 5 57719703 missense probably benign 0.03
IGL02269:Pcdh7 APN 5 57913322 missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58129073 missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0003:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57720060 missense probably damaging 1.00
R0551:Pcdh7 UTSW 5 57721994 missense probably damaging 0.99
R0562:Pcdh7 UTSW 5 57720063 missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57721315 missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57720322 missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57719426 missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57721540 nonsense probably null
R1591:Pcdh7 UTSW 5 57720422 missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57720875 missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57719629 missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58128996 missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58129116 missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57720276 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58129032 missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57721808 missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4236:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57722019 missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58129170 missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57720485 missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57721283 missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58129169 missense probably benign
R4837:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57720804 missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57721916 missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57721601 missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57722166 missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57721748 missense probably benign 0.09
R5132:Pcdh7 UTSW 5 57728121 missense probably benign
R5248:Pcdh7 UTSW 5 58129173 missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57728111 splice site probably null
R5420:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57719514 missense probably damaging 1.00
R5800:Pcdh7 UTSW 5 57722225 missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57721628 missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57721755 missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57721155 missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57720324 missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57721362 missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 57942265 unclassified probably null
R6418:Pcdh7 UTSW 5 57721704 missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57719129 missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57722240 missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57719784 missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57720957 missense probably benign 0.19
R7463:Pcdh7 UTSW 5 57720998 missense probably benign 0.06
R7509:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R7707:Pcdh7 UTSW 5 57720330 missense probably damaging 0.99
R7734:Pcdh7 UTSW 5 57719634 missense probably damaging 0.99
R7899:Pcdh7 UTSW 5 57719810 missense probably benign
R7982:Pcdh7 UTSW 5 57719810 missense probably benign
X0021:Pcdh7 UTSW 5 57721484 missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57719379 missense probably damaging 1.00
Z1177:Pcdh7 UTSW 5 57719664 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATGGCATCGAACGCTACGAG -3'
(R):5'- TACATCCAAATCGGTGGCG -3'

Sequencing Primer
(F):5'- ATCGAACGCTACGAGCTGCTC -3'
(R):5'- GCGCGCAACTGTAGGATG -3'
Posted On2019-10-24