Mutagenetix > Incidental Mutation

Incidental Mutation 'R7588:Rfc1'

587251

Institutional Source

Beutler Lab

Gene Symbol

Rfc1

Ensembl Gene

ENSMUSG00000029191

Gene Name

replication factor C (activator 1) 1

Synonyms

140kDa, Recc1, Alp145, RFC140

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7588 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65261850-65335670 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65272507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 852 (V852A)

Ref Sequence

ENSEMBL: ENSMUSP00000145385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000203596] [ENSMUST00000204965]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000172732
AA Change: V838A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: V838A

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	5.2e-62	PFAM
low complexity region	1104	1132	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000203471
AA Change: V839A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: V839A

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	2.5e-61	PFAM
low complexity region	1104	1132	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000203581
AA Change: V852A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: V852A

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	322	339	N/A	INTRINSIC
low complexity region	356	374	N/A	INTRINSIC
BRCT	415	493	7.39e-17	SMART
low complexity region	498	516	N/A	INTRINSIC
AAA	640	775	9.65e-10	SMART
Pfam:RFC1	912	1065	2.6e-61	PFAM
low complexity region	1117	1145	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203596

SMART Domains

Protein: ENSMUSP00000145181
Gene: ENSMUSG00000029191

Domain	Start	End	E-Value	Type
Pfam:RFC1	2	137	1.7e-46	PFAM
low complexity region	189	212	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000204965
AA Change: V839A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: V839A

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	2.5e-61	PFAM
low complexity region	1104	1131	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	C	17: 28,905,456	K291E	probably benign	Het
Ap2b1	T	A	11: 83,324,522	D97E	probably benign	Het
Apbb1	G	T	7: 105,573,966	P146Q	probably benign	Het
Aste1	T	A	9: 105,397,391	S277T	possibly damaging	Het
Cdk15	A	G	1: 59,344,299	D415G	possibly damaging	Het
Cep152	T	A	2: 125,569,626	E1256D	probably damaging	Het
Chd7	A	G	4: 8,864,039	N2643S	probably damaging	Het
Copg2	A	G	6: 30,811,591		probably null	Het
D130043K22Rik	T	A	13: 24,887,893	I940N	probably damaging	Het
Dnmt3a	A	G	12: 3,896,080	T312A	possibly damaging	Het
Dock5	A	G	14: 67,763,158		probably null	Het
Fam83g	A	T	11: 61,684,696	I55F	probably damaging	Het
Fanci	T	C	7: 79,434,269	F780L	possibly damaging	Het
Fhod3	G	T	18: 25,090,248	A884S	probably benign	Het
Gas6	T	C	8: 13,466,711	S596G	probably benign	Het
Gns	T	C	10: 121,390,658	V404A	probably benign	Het
Gpatch1	T	C	7: 35,291,748	N624D	probably damaging	Het
Hmcn1	T	C	1: 150,657,134	I3099M	possibly damaging	Het
Itga1	A	T	13: 114,968,249	S1080R	possibly damaging	Het
Kcnk15	T	C	2: 163,858,306	V155A	probably damaging	Het
Luzp2	T	A	7: 55,075,090		probably null	Het
Mapk8ip1	T	A	2: 92,386,639	D446V	possibly damaging	Het
Med1	T	C	11: 98,155,572	E1466G	unknown	Het
Mug1	A	G	6: 121,875,517	R855G	probably damaging	Het
Naalad2	C	A	9: 18,351,479	V374F	probably damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nlrp5	A	G	7: 23,408,151	E83G	probably benign	Het
Nod2	T	C	8: 88,674,908	F901S	possibly damaging	Het
Nps	T	C	7: 135,268,779	V10A	probably benign	Het
Pbrm1	T	A	14: 31,084,943	V1109E	probably damaging	Het
Pcdh7	A	G	5: 57,719,904	D267G	probably damaging	Het
Pfkp	A	G	13: 6,648,637	Y15H	possibly damaging	Het
Ppm1b	T	C	17: 85,013,569	S380P	probably benign	Het
Psg21	T	C	7: 18,647,209	N470D	probably benign	Het
Qrich2	T	C	11: 116,465,937	N29D	possibly damaging	Het
Reln	T	C	5: 21,885,568	T3431A	probably benign	Het
Rttn	T	G	18: 89,064,229	D1426E	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Styxl1	G	A	5: 135,770,276	P28L	probably damaging	Het
Tcl1b4	A	G	12: 105,202,382		probably benign	Het
Tmem8	T	C	17: 26,122,043	Y176H	probably damaging	Het
Trav17	A	G	14: 53,806,845	D24G	probably benign	Het
Trim28	A	C	7: 13,029,420	D496A	probably damaging	Het
Trim29	T	C	9: 43,335,128	Y574H	probably damaging	Het
Trip12	G	T	1: 84,760,883	F750L	probably damaging	Het
Ubr3	C	A	2: 69,971,169	T1007K	probably damaging	Het
Zzz3	A	G	3: 152,422,768	Y7C	possibly damaging	Het

Other mutations in Rfc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Rfc1	APN	5	65296009	missense	probably benign	0.00
IGL00909:Rfc1	APN	5	65279699	missense	probably benign	0.00
IGL01791:Rfc1	APN	5	65263145	missense	probably benign	0.00
IGL01884:Rfc1	APN	5	65274460	missense	possibly damaging	0.94
IGL02737:Rfc1	APN	5	65311163	missense	possibly damaging	0.82
Disturbing	UTSW	5	65266162	missense	probably damaging	1.00
P0038:Rfc1	UTSW	5	65287961	missense	probably damaging	1.00
R0317:Rfc1	UTSW	5	65296052	splice site	probably null
R0452:Rfc1	UTSW	5	65264297	missense	probably benign	0.01
R0699:Rfc1	UTSW	5	65319399	splice site	probably null
R0945:Rfc1	UTSW	5	65278709	critical splice donor site	probably null
R1192:Rfc1	UTSW	5	65293911	missense	probably benign	0.03
R1341:Rfc1	UTSW	5	65291194	missense	probably damaging	1.00
R1425:Rfc1	UTSW	5	65319518	missense	probably damaging	1.00
R1551:Rfc1	UTSW	5	65277363	missense	probably damaging	0.99
R1800:Rfc1	UTSW	5	65264379	missense	probably damaging	1.00
R1969:Rfc1	UTSW	5	65319524	missense	probably damaging	1.00
R2006:Rfc1	UTSW	5	65311054	nonsense	probably null
R2026:Rfc1	UTSW	5	65288029	missense	probably damaging	1.00
R2073:Rfc1	UTSW	5	65301939	missense	probably damaging	0.98
R2137:Rfc1	UTSW	5	65311039	critical splice donor site	probably null
R2330:Rfc1	UTSW	5	65312969	missense	possibly damaging	0.94
R3774:Rfc1	UTSW	5	65264406	missense	probably damaging	1.00
R3787:Rfc1	UTSW	5	65296014	missense	probably benign	0.00
R4920:Rfc1	UTSW	5	65287928	missense	probably damaging	1.00
R5055:Rfc1	UTSW	5	65266162	missense	probably damaging	1.00
R5308:Rfc1	UTSW	5	65279461	missense	probably damaging	0.99
R5723:Rfc1	UTSW	5	65277426	missense	probably null	0.78
R5729:Rfc1	UTSW	5	65277452	missense	probably damaging	1.00
R5844:Rfc1	UTSW	5	65293787	missense	probably benign	0.19
R6045:Rfc1	UTSW	5	65279549	missense	probably damaging	1.00
R6484:Rfc1	UTSW	5	65293677	missense	probably benign	0.01
R6495:Rfc1	UTSW	5	65273815	splice site	probably null
R6531:Rfc1	UTSW	5	65312979	missense	possibly damaging	0.92
R6717:Rfc1	UTSW	5	65302004	nonsense	probably null
R6717:Rfc1	UTSW	5	65312961	missense	probably damaging	0.97
R6845:Rfc1	UTSW	5	65311116	missense	possibly damaging	0.53
R6880:Rfc1	UTSW	5	65277386	missense	probably benign	0.14
R7329:Rfc1	UTSW	5	65263135	missense	unknown
R7331:Rfc1	UTSW	5	65311044	missense	probably damaging	1.00
R7466:Rfc1	UTSW	5	65275426	missense	probably damaging	1.00
R7497:Rfc1	UTSW	5	65279498	missense	probably damaging	1.00
R8020:Rfc1	UTSW	5	65272178	missense	probably damaging	1.00
R8056:Rfc1	UTSW	5	65294093	intron	probably benign
R8282:Rfc1	UTSW	5	65268946	critical splice donor site	probably null
R8316:Rfc1	UTSW	5	65278734	missense	probably benign	0.05
R8320:Rfc1	UTSW	5	65303036	nonsense	probably null
R8865:Rfc1	UTSW	5	65278792	missense	possibly damaging	0.89
R8968:Rfc1	UTSW	5	65275435	missense	probably benign	0.03
R8997:Rfc1	UTSW	5	65275721	missense	probably damaging	1.00
R9454:Rfc1	UTSW	5	65274431	missense
R9476:Rfc1	UTSW	5	65279799	missense	probably damaging	0.99
R9631:Rfc1	UTSW	5	65272508	missense	probably damaging	1.00
R9758:Rfc1	UTSW	5	65302048	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGTGGTGTAGAGAACCCC -3'
(R):5'- TTCCACAGTTGGGATGAAAGTG -3'

Sequencing Primer
(F):5'- TGTAGAGAACCCCGATCCTG -3'
(R):5'- GCTAGAACACTATGTGTAGGATTTTG -3'

Posted On

2019-10-24