Incidental Mutation 'R7588:Styxl1'
ID587252
Institutional Source Beutler Lab
Gene Symbol Styxl1
Ensembl Gene ENSMUSG00000019178
Gene Nameserine/threonine/tyrosine interacting-like 1
Synonyms1700011C14Rik, Dusp24
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135747220-135778385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135770276 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 28 (P28L)
Ref Sequence ENSEMBL: ENSMUSP00000051216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053906] [ENSMUST00000111161] [ENSMUST00000111162] [ENSMUST00000111163] [ENSMUST00000111164] [ENSMUST00000142343] [ENSMUST00000177559] [ENSMUST00000178515] [ENSMUST00000178796]
Predicted Effect probably damaging
Transcript: ENSMUST00000053906
AA Change: P28L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051216
Gene: ENSMUSG00000019178
AA Change: P28L

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111161
SMART Domains Protein: ENSMUSP00000106791
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111162
AA Change: P28L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106792
Gene: ENSMUSG00000019178
AA Change: P28L

DomainStartEndE-ValueType
Pfam:DSPc 64 203 2.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111163
AA Change: P28L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106793
Gene: ENSMUSG00000019178
AA Change: P28L

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111164
AA Change: P28L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106794
Gene: ENSMUSG00000019178
AA Change: P28L

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142343
AA Change: P28L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136983
Gene: ENSMUSG00000019178
AA Change: P28L

DomainStartEndE-ValueType
Blast:RHOD 17 62 8e-19 BLAST
SCOP:d1gmxa_ 23 67 6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177559
AA Change: P28L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135982
Gene: ENSMUSG00000019178
AA Change: P28L

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178515
SMART Domains Protein: ENSMUSP00000137191
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178796
AA Change: P38L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137481
Gene: ENSMUSG00000019178
AA Change: P38L

DomainStartEndE-ValueType
RHOD 27 158 1.31e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Styxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Styxl1 APN 5 135765750 missense probably damaging 1.00
IGL02735:Styxl1 APN 5 135759142 missense probably damaging 1.00
IGL03284:Styxl1 APN 5 135757095 missense possibly damaging 0.65
R1263:Styxl1 UTSW 5 135753883 missense probably damaging 1.00
R1533:Styxl1 UTSW 5 135770321 missense probably damaging 1.00
R1987:Styxl1 UTSW 5 135757122 missense probably damaging 1.00
R2399:Styxl1 UTSW 5 135747781 missense possibly damaging 0.80
R3040:Styxl1 UTSW 5 135757033 missense probably damaging 1.00
R3411:Styxl1 UTSW 5 135765764 missense probably damaging 1.00
R4085:Styxl1 UTSW 5 135759165 missense unknown
R4772:Styxl1 UTSW 5 135768901 nonsense probably null
R5667:Styxl1 UTSW 5 135757123 unclassified probably null
R6376:Styxl1 UTSW 5 135747810 missense probably benign 0.04
R6601:Styxl1 UTSW 5 135755496 missense probably benign 0.30
R7735:Styxl1 UTSW 5 135759169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGCCTTTTGAACCAAC -3'
(R):5'- ACAGTTTCCTTGGTAGTATATGGC -3'

Sequencing Primer
(F):5'- GCAGCCTTTTGAACCAACCATTC -3'
(R):5'- TAGGCAAGCACTCTGTCAATCG -3'
Posted On2019-10-24