Incidental Mutation 'R7588:Psg21'
ID 587256
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific beta-1-glycoprotein 21
Synonyms 1600019C01Rik, 1600026N13Rik, 1600025N01Rik, cea8
MMRRC Submission 045636-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R7588 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18380661-18390650 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18381134 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 470 (N470D)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably benign
Transcript: ENSMUST00000094793
AA Change: N470D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: N470D

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2b1 T A 11: 83,215,348 (GRCm39) D97E probably benign Het
Apbb1 G T 7: 105,223,173 (GRCm39) P146Q probably benign Het
Aste1 T A 9: 105,274,590 (GRCm39) S277T possibly damaging Het
Bnip5 T C 17: 29,124,430 (GRCm39) K291E probably benign Het
Cdk15 A G 1: 59,383,458 (GRCm39) D415G possibly damaging Het
Cep152 T A 2: 125,411,546 (GRCm39) E1256D probably damaging Het
Chd7 A G 4: 8,864,039 (GRCm39) N2643S probably damaging Het
Copg2 A G 6: 30,788,526 (GRCm39) probably null Het
D130043K22Rik T A 13: 25,071,876 (GRCm39) I940N probably damaging Het
Dnmt3a A G 12: 3,946,080 (GRCm39) T312A possibly damaging Het
Dock5 A G 14: 68,000,607 (GRCm39) probably null Het
Fam83g A T 11: 61,575,522 (GRCm39) I55F probably damaging Het
Fanci T C 7: 79,084,017 (GRCm39) F780L possibly damaging Het
Fhod3 G T 18: 25,223,305 (GRCm39) A884S probably benign Het
Gas6 T C 8: 13,516,711 (GRCm39) S596G probably benign Het
Gns T C 10: 121,226,563 (GRCm39) V404A probably benign Het
Gpatch1 T C 7: 34,991,173 (GRCm39) N624D probably damaging Het
Hmcn1 T C 1: 150,532,885 (GRCm39) I3099M possibly damaging Het
Itga1 A T 13: 115,104,785 (GRCm39) S1080R possibly damaging Het
Kcnk15 T C 2: 163,700,226 (GRCm39) V155A probably damaging Het
Luzp2 T A 7: 54,724,838 (GRCm39) probably null Het
Mapk8ip1 T A 2: 92,216,984 (GRCm39) D446V possibly damaging Het
Med1 T C 11: 98,046,398 (GRCm39) E1466G unknown Het
Mug1 A G 6: 121,852,476 (GRCm39) R855G probably damaging Het
Naalad2 C A 9: 18,262,775 (GRCm39) V374F probably damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nlrp5 A G 7: 23,107,576 (GRCm39) E83G probably benign Het
Nod2 T C 8: 89,401,536 (GRCm39) F901S possibly damaging Het
Nps T C 7: 134,870,508 (GRCm39) V10A probably benign Het
Pbrm1 T A 14: 30,806,900 (GRCm39) V1109E probably damaging Het
Pcdh7 A G 5: 57,877,246 (GRCm39) D267G probably damaging Het
Pfkp A G 13: 6,698,673 (GRCm39) Y15H possibly damaging Het
Pgap6 T C 17: 26,341,017 (GRCm39) Y176H probably damaging Het
Ppm1b T C 17: 85,320,997 (GRCm39) S380P probably benign Het
Qrich2 T C 11: 116,356,763 (GRCm39) N29D possibly damaging Het
Reln T C 5: 22,090,566 (GRCm39) T3431A probably benign Het
Rfc1 A G 5: 65,429,850 (GRCm39) V852A probably damaging Het
Rttn T G 18: 89,082,353 (GRCm39) D1426E probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Styxl1 G A 5: 135,799,130 (GRCm39) P28L probably damaging Het
Tcl1b4 A G 12: 105,168,641 (GRCm39) probably benign Het
Trav17 A G 14: 54,044,302 (GRCm39) D24G probably benign Het
Trim28 A C 7: 12,763,347 (GRCm39) D496A probably damaging Het
Trim29 T C 9: 43,246,425 (GRCm39) Y574H probably damaging Het
Trip12 G T 1: 84,738,604 (GRCm39) F750L probably damaging Het
Ubr3 C A 2: 69,801,513 (GRCm39) T1007K probably damaging Het
Zzz3 A G 3: 152,128,405 (GRCm39) Y7C possibly damaging Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18,388,750 (GRCm39) missense probably damaging 1.00
IGL02390:Psg21 APN 7 18,386,556 (GRCm39) missense probably benign 0.11
IGL02548:Psg21 APN 7 18,388,961 (GRCm39) missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18,386,410 (GRCm39) missense probably benign 0.03
IGL03135:Psg21 APN 7 18,388,843 (GRCm39) missense probably benign 0.00
R0131:Psg21 UTSW 7 18,388,793 (GRCm39) missense probably benign 0.39
R0551:Psg21 UTSW 7 18,386,565 (GRCm39) critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18,390,425 (GRCm39) missense probably benign 0.00
R1874:Psg21 UTSW 7 18,384,741 (GRCm39) missense probably benign 0.15
R1993:Psg21 UTSW 7 18,388,695 (GRCm39) missense probably benign 0.04
R2327:Psg21 UTSW 7 18,386,378 (GRCm39) missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18,386,305 (GRCm39) missense probably damaging 1.00
R4422:Psg21 UTSW 7 18,381,257 (GRCm39) missense probably damaging 1.00
R5138:Psg21 UTSW 7 18,390,453 (GRCm39) start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18,388,939 (GRCm39) missense probably damaging 1.00
R5686:Psg21 UTSW 7 18,386,183 (GRCm39) intron probably benign
R6166:Psg21 UTSW 7 18,390,664 (GRCm39) unclassified probably benign
R6177:Psg21 UTSW 7 18,386,279 (GRCm39) missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18,388,926 (GRCm39) missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18,386,270 (GRCm39) missense probably damaging 1.00
R6482:Psg21 UTSW 7 18,388,664 (GRCm39) splice site probably null
R6729:Psg21 UTSW 7 18,386,516 (GRCm39) missense probably damaging 1.00
R6866:Psg21 UTSW 7 18,386,209 (GRCm39) missense probably damaging 1.00
R6992:Psg21 UTSW 7 18,388,668 (GRCm39) critical splice donor site probably null
R7075:Psg21 UTSW 7 18,388,786 (GRCm39) missense probably damaging 1.00
R7081:Psg21 UTSW 7 18,388,774 (GRCm39) nonsense probably null
R7098:Psg21 UTSW 7 18,386,470 (GRCm39) missense probably damaging 1.00
R7582:Psg21 UTSW 7 18,381,128 (GRCm39) makesense probably null
R7607:Psg21 UTSW 7 18,388,708 (GRCm39) missense probably benign 0.02
R7830:Psg21 UTSW 7 18,381,223 (GRCm39) missense probably damaging 1.00
R7964:Psg21 UTSW 7 18,381,136 (GRCm39) missense probably benign 0.01
R8758:Psg21 UTSW 7 18,384,678 (GRCm39) missense probably damaging 1.00
R8972:Psg21 UTSW 7 18,381,293 (GRCm39) missense probably benign 0.03
R8988:Psg21 UTSW 7 18,386,389 (GRCm39) missense probably benign 0.00
R9119:Psg21 UTSW 7 18,381,409 (GRCm39) missense probably benign 0.14
R9446:Psg21 UTSW 7 18,388,865 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACTGTGCAACAATAGTGAG -3'
(R):5'- CCGTTGGCTCTTCAACAATCAG -3'

Sequencing Primer
(F):5'- ACAGACATTGTGGTACCATATGCTCC -3'
(R):5'- GGCTCTTCAACAATCAGAGTCTG -3'
Posted On 2019-10-24