Mutagenetix > Incidental Mutations

Incidental Mutation 'R0622:Grm7'

58726

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik

MMRRC Submission

038811-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0622 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110645581-111567230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 111358496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 623 (A623T)

Ref Sequence

ENSEMBL: ENSMUSP00000133957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: A623T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: A623T

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172951
AA Change: A623T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: A623T

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174018

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtr1a	T	A	13: 30,381,681	M243K	probably benign	Het
Ap1b1	A	G	11: 5,037,707	M744V	probably damaging	Het
C87977	T	C	4: 144,213,013		probably benign	Het
Ccdc152	T	C	15: 3,298,178	N39S	probably damaging	Het
Cd163	G	A	6: 124,317,352	V490M	probably damaging	Het
Col6a5	G	T	9: 105,925,852	H1305N	unknown	Het
Cpb1	C	A	3: 20,249,818	D361Y	probably damaging	Het
Dchs1	T	A	7: 105,763,449	Y1248F	probably damaging	Het
Dhdds	G	C	4: 133,994,236	F83L	probably damaging	Het
Dsg4	T	A	18: 20,449,788	V161E	possibly damaging	Het
Exosc4	A	G	15: 76,327,536	D15G	probably damaging	Het
F3	A	T	3: 121,725,019	D44V	probably damaging	Het
Fat2	A	T	11: 55,283,128	F2253Y	probably damaging	Het
Fbn1	T	C	2: 125,379,024	D650G	possibly damaging	Het
Gramd4	T	A	15: 86,091,389	F36I	probably damaging	Het
Gys1	A	T	7: 45,439,995	T193S	probably damaging	Het
Hectd4	A	G	5: 121,348,625	T3228A	possibly damaging	Het
Itpk1	G	T	12: 102,573,980	D281E	probably damaging	Het
Kcnh7	A	C	2: 62,837,289		probably null	Het
Klhl29	A	G	12: 5,081,224	L852P	probably damaging	Het
Lrch1	T	C	14: 74,796,051	Y509C	probably benign	Het
Lrp1b	A	G	2: 41,728,551		probably null	Het
Mcpt4	C	A	14: 56,060,662	R144L	probably benign	Het
Mia2	C	T	12: 59,131,578	R12W	probably damaging	Het
Mrps5	A	G	2: 127,594,531	K116R	probably benign	Het
Myrf	G	A	19: 10,223,452	P286S	probably damaging	Het
Nanp	A	G	2: 151,039,244	M28T	probably benign	Het
Neb	T	C	2: 52,212,951	I4472V	probably benign	Het
Nfix	A	C	8: 84,726,482	N314K	probably damaging	Het
Nlrc3	C	T	16: 3,953,968	R849Q	probably benign	Het
Nup210l	G	A	3: 90,167,740	V786M	probably damaging	Het
Olfr1346	T	C	7: 6,474,599	I163T	possibly damaging	Het
Olfr314	T	C	11: 58,786,341	S36P	probably damaging	Het
Olfr600	A	G	7: 103,346,857	S24P	probably damaging	Het
Olfr898	A	G	9: 38,349,371	N96S	possibly damaging	Het
Pdia4	A	T	6: 47,806,518	F197Y	probably damaging	Het
Phldb1	T	C	9: 44,715,852	D432G	probably damaging	Het
Pik3ca	A	G	3: 32,436,552	E116G	probably damaging	Het
Polq	T	C	16: 37,060,993	V1173A	probably benign	Het
Pou2f3	C	T	9: 43,125,119	R423H	probably damaging	Het
Prkag2	T	C	5: 24,869,249	N246S	probably damaging	Het
Proser1	A	G	3: 53,477,860	S388G	probably benign	Het
Ralgps1	G	A	2: 33,174,447	R238*	probably null	Het
Rfx2	T	C	17: 56,777,071	D657G	probably damaging	Het
Ryr3	A	G	2: 112,662,555	F3724S	probably damaging	Het
Sh2d5	T	C	4: 138,259,228	S421P	probably damaging	Het
Slc17a2	C	A	13: 23,812,611	T33K	probably damaging	Het
St8sia5	A	G	18: 77,246,113	T156A	probably damaging	Het
Stk32c	T	C	7: 139,188,110	D85G	probably benign	Het
Tnks	A	G	8: 34,940,822	S251P	probably damaging	Het
Tnxb	T	A	17: 34,718,729	L3864Q	probably damaging	Het
Trim9	A	G	12: 70,346,604	Y189H	probably damaging	Het
Vmn1r77	T	G	7: 12,041,388	F30L	probably benign	Het
Wasf3	A	G	5: 146,466,792		probably null	Het
Wdr90	C	T	17: 25,855,658	C603Y	probably damaging	Het
Zdhhc25	T	C	15: 88,601,107	L215P	probably damaging	Het
Zeb1	C	T	18: 5,759,123	Q140*	probably null	Het
Zfp677	C	T	17: 21,397,700	L340F	probably benign	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111246184	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111358317	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111358958	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111254020	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111495643	splice site	probably null
IGL03185:Grm7	APN	6	110646222	missense	possibly damaging	0.84
Appropriated	UTSW	6	111495681	missense	possibly damaging	0.64
Consumed	UTSW	6	111358875	missense	probably damaging	1.00
Devoured	UTSW	6	111358824	missense	probably damaging	1.00
shaky	UTSW	6	111495791	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110646089	missense	probably benign
R0539:Grm7	UTSW	6	111359094	splice site	probably benign
R1356:Grm7	UTSW	6	111359024	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111495791	nonsense	probably null
R1823:Grm7	UTSW	6	111207769	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111080423	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111358607	missense	probably benign
R1987:Grm7	UTSW	6	110914511	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111207808	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110646137	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111358997	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111495681	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111495905	splice site	probably null
R2923:Grm7	UTSW	6	111495905	splice site	probably null
R3014:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111495722	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110914340	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111254020	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110914364	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111246374	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111358304	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110914546	splice site	probably null
R4647:Grm7	UTSW	6	110914383	nonsense	probably null
R4714:Grm7	UTSW	6	111080422	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110914371	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111358863	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111080443	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110646136	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111358221	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111358426	missense	probably benign
R6026:Grm7	UTSW	6	111501539	nonsense	probably null
R6174:Grm7	UTSW	6	111246297	missense	probably benign
R6305:Grm7	UTSW	6	111358665	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111358875	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111254020	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111207752	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111358425	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111358353	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	110646304	missense	probably benign	0.03
R6949:Grm7	UTSW	6	111495729	missense	probably damaging	1.00
R6989:Grm7	UTSW	6	111207805	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111358152	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111358824	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110646118	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110646013	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111501515	missense
R7567:Grm7	UTSW	6	111358761	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111246353	nonsense	probably null
R8018:Grm7	UTSW	6	111207776	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111566039	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110914336	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111080354	missense	probably benign
R8523:Grm7	UTSW	6	111246319	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111254005	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111495822	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111495768	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111358913	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110645908	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111254116
Z1176:Grm7	UTSW	6	111358149	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATTGTCCCTATGACCAGAGGC -3'
(R):5'- TGGGAGCTGTCACCGATTTCTTGC -3'

Sequencing Primer
(F):5'- CTATGACCAGAGGCCCAATGAG -3'
(R):5'- CTGCTCGAATATGCGATAAATCCG -3'

Posted On

2013-07-11