Incidental Mutation 'R7588:Apbb1'
ID587261
Institutional Source Beutler Lab
Gene Symbol Apbb1
Ensembl Gene ENSMUSG00000037032
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1
SynonymsFe65, Rir
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105558483-105581653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105573966 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 146 (P146Q)
Ref Sequence ENSEMBL: ENSMUSP00000140973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081165] [ENSMUST00000186868] [ENSMUST00000187051] [ENSMUST00000187683] [ENSMUST00000188440] [ENSMUST00000188726] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601] [ENSMUST00000210079]
Predicted Effect probably benign
Transcript: ENSMUST00000081165
AA Change: P146Q

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: P146Q

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186868
SMART Domains Protein: ENSMUSP00000140052
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187051
SMART Domains Protein: ENSMUSP00000139755
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
SCOP:d1shca_ 74 120 9e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187683
SMART Domains Protein: ENSMUSP00000139426
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 2.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Pfam:PID 111 158 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188440
SMART Domains Protein: ENSMUSP00000140715
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 3.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 223 1.4e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188726
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189378
AA Change: P146Q

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: P146Q

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191011
AA Change: P146Q

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: P146Q

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191601
AA Change: P146Q

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: P146Q

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210079
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Apbb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Apbb1 APN 7 105559126 splice site probably benign
athena UTSW 7 105566695 missense probably benign
R0092:Apbb1 UTSW 7 105559154 missense probably damaging 1.00
R0348:Apbb1 UTSW 7 105565303 missense probably damaging 0.98
R0633:Apbb1 UTSW 7 105558963 missense probably damaging 1.00
R0946:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1076:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1332:Apbb1 UTSW 7 105565543 missense possibly damaging 0.74
R1658:Apbb1 UTSW 7 105574084 missense probably damaging 1.00
R1739:Apbb1 UTSW 7 105574227 missense probably benign
R4230:Apbb1 UTSW 7 105567684 missense probably damaging 1.00
R4296:Apbb1 UTSW 7 105573826 missense probably benign 0.16
R4385:Apbb1 UTSW 7 105567276 missense probably benign 0.00
R4571:Apbb1 UTSW 7 105573762 missense probably damaging 1.00
R4647:Apbb1 UTSW 7 105565538 missense probably benign 0.01
R4812:Apbb1 UTSW 7 105574025 missense probably damaging 0.99
R5044:Apbb1 UTSW 7 105565682 intron probably benign
R5109:Apbb1 UTSW 7 105565035 missense probably damaging 1.00
R5479:Apbb1 UTSW 7 105565025 missense probably damaging 0.97
R5611:Apbb1 UTSW 7 105559483 missense probably damaging 1.00
R5677:Apbb1 UTSW 7 105559246 missense probably damaging 1.00
R5785:Apbb1 UTSW 7 105567715 missense probably damaging 1.00
R5850:Apbb1 UTSW 7 105567583 missense probably damaging 1.00
R5896:Apbb1 UTSW 7 105574225 missense probably damaging 1.00
R6151:Apbb1 UTSW 7 105574252 nonsense probably null
R6186:Apbb1 UTSW 7 105567726 missense probably damaging 1.00
R6229:Apbb1 UTSW 7 105573730 missense probably damaging 0.98
R6229:Apbb1 UTSW 7 105573731 missense probably damaging 0.98
R6288:Apbb1 UTSW 7 105559227 missense probably damaging 1.00
R6295:Apbb1 UTSW 7 105566695 missense probably benign
R6443:Apbb1 UTSW 7 105573763 missense probably damaging 1.00
R6729:Apbb1 UTSW 7 105565381 missense probably damaging 1.00
R7130:Apbb1 UTSW 7 105565331 missense probably damaging 0.98
R7209:Apbb1 UTSW 7 105566085 missense probably damaging 1.00
R7467:Apbb1 UTSW 7 105566132 missense probably benign 0.04
R7489:Apbb1 UTSW 7 105567480 missense probably benign 0.30
R7754:Apbb1 UTSW 7 105559302 missense probably damaging 0.97
R7768:Apbb1 UTSW 7 105567088 missense probably benign
R7785:Apbb1 UTSW 7 105567423 missense probably benign 0.00
R7804:Apbb1 UTSW 7 105566600 missense probably damaging 1.00
R7809:Apbb1 UTSW 7 105573807 missense probably benign 0.04
R7995:Apbb1 UTSW 7 105565645 missense probably benign 0.09
R8044:Apbb1 UTSW 7 105573887 small deletion probably benign
Z1088:Apbb1 UTSW 7 105559136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTGGCTGCACTGTTTCG -3'
(R):5'- CCAGAACCGAAATGTGACCTTG -3'

Sequencing Primer
(F):5'- CACTGTTTCGCATGCCAAATAGGAG -3'
(R):5'- GAACCGAAATGTGACCTTGACCTTG -3'
Posted On2019-10-24