Incidental Mutation 'R7588:Naalad2'
ID587265
Institutional Source Beutler Lab
Gene Symbol Naalad2
Ensembl Gene ENSMUSG00000043943
Gene NameN-acetylated alpha-linked acidic dipeptidase 2
SynonymsNAADALASE2, GCP3, NAALADASE2, Folh1b, GCPIII, D9Ertd285e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R7588 (G1)
Quality Score188.009
Status Not validated
Chromosome9
Chromosomal Location18321951-18402995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18351479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 374 (V374F)
Ref Sequence ENSEMBL: ENSMUSP00000001826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001826] [ENSMUST00000166825] [ENSMUST00000172171]
Predicted Effect probably damaging
Transcript: ENSMUST00000001826
AA Change: V374F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001826
Gene: ENSMUSG00000043943
AA Change: V374F

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 198 290 2.2e-14 PFAM
Pfam:Peptidase_M28 385 593 9.4e-22 PFAM
Pfam:TFR_dimer 655 775 1.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166825
AA Change: V336F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128674
Gene: ENSMUSG00000043943
AA Change: V336F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PA 155 253 2.8e-14 PFAM
Pfam:Peptidase_M28 360 554 8.2e-18 PFAM
Pfam:TFR_dimer 616 739 3.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172171
AA Change: V374F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130752
Gene: ENSMUSG00000043943
AA Change: V374F

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 193 291 3.5e-14 PFAM
Pfam:Peptidase_M28 398 592 1.2e-17 PFAM
Pfam:TFR_dimer 654 777 6.4e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-acetylated alpha-linked acidic dipeptidase (NAALADase) gene family. The representative member of this family is the gene encoding human prostate-specific membrane antigen (PSM), which is a marker of prostatic carcinomas and is the first to be shown to possess NAALADase activity. NAALADase cleaves N-acetyl-L-aspartate-L-glutamate (NAAG), which is a neuropeptide expressed both in the central nervous systems and in the periphery and is thought to function as a neurotransmitter. The product of this gene is a type II integral membrane protein. Transient transfection of this gene confers both NAALADase and dipetidyl peptidase IV activities to mammalian cells. This gene is highly expressed in ovary and testis as well as within discrete brain areas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Naalad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Naalad2 APN 9 18327373 missense probably damaging 0.97
IGL02160:Naalad2 APN 9 18379937 missense probably damaging 1.00
IGL03246:Naalad2 APN 9 18385099 missense possibly damaging 0.92
IGL03351:Naalad2 APN 9 18364187 missense possibly damaging 0.57
ithaca UTSW 9 18378699 missense probably damaging 1.00
odysseus UTSW 9 18376533 missense possibly damaging 0.63
R0112:Naalad2 UTSW 9 18351447 nonsense probably null
R0266:Naalad2 UTSW 9 18350943 splice site probably benign
R0505:Naalad2 UTSW 9 18385895 missense probably benign
R1077:Naalad2 UTSW 9 18347506 missense probably damaging 1.00
R1442:Naalad2 UTSW 9 18351032 splice site probably benign
R1553:Naalad2 UTSW 9 18378669 missense probably benign 0.01
R1694:Naalad2 UTSW 9 18327387 missense probably damaging 0.96
R1912:Naalad2 UTSW 9 18376535 missense probably benign 0.00
R1976:Naalad2 UTSW 9 18378699 missense probably damaging 1.00
R2224:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2225:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2227:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2287:Naalad2 UTSW 9 18335021 splice site probably null
R4126:Naalad2 UTSW 9 18347470 missense probably damaging 1.00
R4784:Naalad2 UTSW 9 18350918 missense probably damaging 1.00
R5426:Naalad2 UTSW 9 18347519 missense probably benign 0.11
R5470:Naalad2 UTSW 9 18330851 missense probably damaging 1.00
R5644:Naalad2 UTSW 9 18334931 missense possibly damaging 0.90
R5888:Naalad2 UTSW 9 18330641 missense probably benign 0.34
R6194:Naalad2 UTSW 9 18351147 missense probably benign 0.23
R6238:Naalad2 UTSW 9 18385065 missense probably damaging 1.00
R6701:Naalad2 UTSW 9 18385148 missense probably null 0.05
R6764:Naalad2 UTSW 9 18402889 start gained probably benign
R6791:Naalad2 UTSW 9 18385130 missense possibly damaging 0.67
R7133:Naalad2 UTSW 9 18327377 missense probably benign 0.00
R7137:Naalad2 UTSW 9 18323487 missense probably benign 0.00
R7212:Naalad2 UTSW 9 18364041 intron probably null
Z1177:Naalad2 UTSW 9 18351102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTTCAGTGTCAAGTCAGCC -3'
(R):5'- AAGTTGGCTTTCAGGTACATGC -3'

Sequencing Primer
(F):5'- TCAGTGTCAAGTCAGCCAAAATAG -3'
(R):5'- GGCTTTCAGGTACATGCATAAATCC -3'
Posted On2019-10-24