Incidental Mutation 'R7588:Aste1'
ID587267
Institutional Source Beutler Lab
Gene Symbol Aste1
Ensembl Gene ENSMUSG00000032567
Gene Nameasteroid homolog 1
Synonyms1100001A21Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_025651.4, NM_001164828.1; MGI:1913845

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location105395392-105412229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105397391 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 277 (S277T)
Ref Sequence ENSEMBL: ENSMUSP00000035181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000038648] [ENSMUST00000123807] [ENSMUST00000140851] [ENSMUST00000156256] [ENSMUST00000167674] [ENSMUST00000176350] [ENSMUST00000176940] [ENSMUST00000177029] [ENSMUST00000177402] [ENSMUST00000189758]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035181
AA Change: S277T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567
AA Change: S277T

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038648
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123807
AA Change: S216T

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000123807
AA Change: S216T

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000140851
SMART Domains Protein: ENSMUSP00000116864
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156256
SMART Domains Protein: ENSMUSP00000116761
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
Pfam:Pkinase 30 177 8.9e-36 PFAM
Pfam:Pkinase_Tyr 30 178 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167674
SMART Domains Protein: ENSMUSP00000131164
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect unknown
Transcript: ENSMUST00000176940
AA Change: S277T
Predicted Effect probably benign
Transcript: ENSMUST00000177029
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted(4) Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Aste1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Aste1 APN 9 105397844 missense probably damaging 0.99
IGL03161:Aste1 APN 9 105396672 missense probably damaging 1.00
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R1485:Aste1 UTSW 9 105397810 nonsense probably null
R2010:Aste1 UTSW 9 105403502 missense probably damaging 1.00
R5048:Aste1 UTSW 9 105396989 missense probably damaging 1.00
R5084:Aste1 UTSW 9 105397687 nonsense probably null
R5091:Aste1 UTSW 9 105405004 missense probably damaging 1.00
R5197:Aste1 UTSW 9 105405054 missense probably damaging 1.00
R5294:Aste1 UTSW 9 105402705 splice site probably null
R5617:Aste1 UTSW 9 105397835 missense probably benign 0.00
R5834:Aste1 UTSW 9 105403415 missense probably benign 0.01
R6214:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6215:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6249:Aste1 UTSW 9 105396617 missense probably benign 0.00
R6913:Aste1 UTSW 9 105397408 missense probably benign 0.01
R7069:Aste1 UTSW 9 105396707 critical splice donor site probably null
R7155:Aste1 UTSW 9 105405136 missense probably damaging 1.00
R7360:Aste1 UTSW 9 105397636 missense probably damaging 0.97
R7488:Aste1 UTSW 9 105402705 splice site probably null
R7734:Aste1 UTSW 9 105397479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTGTGTGGAAATGACCATG -3'
(R):5'- GTGTGTGAAGAAAGGTCCTTCG -3'

Sequencing Primer
(F):5'- GTGGAAATGACCATGTTAACCTGCC -3'
(R):5'- GTCCTTCGGAGCACCAAAG -3'
Posted On2019-10-24