Incidental Mutation 'R0622:Cd163'
ID58727
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0622 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124317352 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 490 (V490M)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably damaging
Transcript: ENSMUST00000032234
AA Change: V490M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: V490M

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112541
AA Change: V490M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: V490M

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203210
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Gys1 A T 7: 45,439,995 T193S probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
compass UTSW 6 124329086 makesense probably null
hottish UTSW 6 124309208 missense probably damaging 1.00
protractor UTSW 6 124311566 missense probably damaging 1.00
t-square UTSW 6 124325288 missense probably damaging 0.97
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
R6993:Cd163 UTSW 6 124317714 missense probably damaging 1.00
R7345:Cd163 UTSW 6 124318938 missense possibly damaging 0.52
R7552:Cd163 UTSW 6 124307228 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTGACAGAGCCCAAACTGTGAAC -3'
(R):5'- ATGGGACTCATCCCCACTACACTG -3'

Sequencing Primer
(F):5'- TTCTTAGAAGGACAAGCCCAATG -3'
(R):5'- ACACTGGAATTCTTCACCCC -3'
Posted On2013-07-11