Mutagenetix > Incidental Mutation

Incidental Mutation 'R7588:Ap2b1'

587270

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7588 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83324522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 97 (D97E)

Ref Sequence

ENSEMBL: ENSMUSP00000018875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

AlphaFold

Q9DBG3

Predicted Effect

probably benign
Transcript: ENSMUST00000018875
AA Change: D97E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: D97E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065692
AA Change: D97E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: D97E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176430
AA Change: D97E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: D97E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176944
AA Change: D97E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: D97E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	C	17: 28,905,456	K291E	probably benign	Het
Apbb1	G	T	7: 105,573,966	P146Q	probably benign	Het
Aste1	T	A	9: 105,397,391	S277T	possibly damaging	Het
Cdk15	A	G	1: 59,344,299	D415G	possibly damaging	Het
Cep152	T	A	2: 125,569,626	E1256D	probably damaging	Het
Chd7	A	G	4: 8,864,039	N2643S	probably damaging	Het
Copg2	A	G	6: 30,811,591		probably null	Het
D130043K22Rik	T	A	13: 24,887,893	I940N	probably damaging	Het
Dnmt3a	A	G	12: 3,896,080	T312A	possibly damaging	Het
Dock5	A	G	14: 67,763,158		probably null	Het
Fam83g	A	T	11: 61,684,696	I55F	probably damaging	Het
Fanci	T	C	7: 79,434,269	F780L	possibly damaging	Het
Fhod3	G	T	18: 25,090,248	A884S	probably benign	Het
Gas6	T	C	8: 13,466,711	S596G	probably benign	Het
Gns	T	C	10: 121,390,658	V404A	probably benign	Het
Gpatch1	T	C	7: 35,291,748	N624D	probably damaging	Het
Hmcn1	T	C	1: 150,657,134	I3099M	possibly damaging	Het
Itga1	A	T	13: 114,968,249	S1080R	possibly damaging	Het
Kcnk15	T	C	2: 163,858,306	V155A	probably damaging	Het
Luzp2	T	A	7: 55,075,090		probably null	Het
Mapk8ip1	T	A	2: 92,386,639	D446V	possibly damaging	Het
Med1	T	C	11: 98,155,572	E1466G	unknown	Het
Mug1	A	G	6: 121,875,517	R855G	probably damaging	Het
Naalad2	C	A	9: 18,351,479	V374F	probably damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nlrp5	A	G	7: 23,408,151	E83G	probably benign	Het
Nod2	T	C	8: 88,674,908	F901S	possibly damaging	Het
Nps	T	C	7: 135,268,779	V10A	probably benign	Het
Pbrm1	T	A	14: 31,084,943	V1109E	probably damaging	Het
Pcdh7	A	G	5: 57,719,904	D267G	probably damaging	Het
Pfkp	A	G	13: 6,648,637	Y15H	possibly damaging	Het
Ppm1b	T	C	17: 85,013,569	S380P	probably benign	Het
Psg21	T	C	7: 18,647,209	N470D	probably benign	Het
Qrich2	T	C	11: 116,465,937	N29D	possibly damaging	Het
Reln	T	C	5: 21,885,568	T3431A	probably benign	Het
Rfc1	A	G	5: 65,272,507	V852A	probably damaging	Het
Rttn	T	G	18: 89,064,229	D1426E	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Styxl1	G	A	5: 135,770,276	P28L	probably damaging	Het
Tcl1b4	A	G	12: 105,202,382		probably benign	Het
Tmem8	T	C	17: 26,122,043	Y176H	probably damaging	Het
Trav17	A	G	14: 53,806,845	D24G	probably benign	Het
Trim28	A	C	7: 13,029,420	D496A	probably damaging	Het
Trim29	T	C	9: 43,335,128	Y574H	probably damaging	Het
Trip12	G	T	1: 84,760,883	F750L	probably damaging	Het
Ubr3	C	A	2: 69,971,169	T1007K	probably damaging	Het
Zzz3	A	G	3: 152,422,768	Y7C	possibly damaging	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCAGGCTCTCGAGTAGAC -3'
(R):5'- TGAGATCCCGCAGAGAATCC -3'

Sequencing Primer
(F):5'- CGAGTAGACAACTAAAACCTTTAGG -3'
(R):5'- GAGAATCCAGAAATCCCTGATCTTC -3'

Posted On

2019-10-24