Incidental Mutation 'R7588:Med1'
ID587271
Institutional Source Beutler Lab
Gene Symbol Med1
Ensembl Gene ENSMUSG00000018160
Gene Namemediator complex subunit 1
SynonymsPparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98152154-98193293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98155572 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1466 (E1466G)
Ref Sequence ENSEMBL: ENSMUSP00000103169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000107545]
Predicted Effect unknown
Transcript: ENSMUST00000018304
AA Change: E1451G
SMART Domains Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160
AA Change: E1451G

DomainStartEndE-ValueType
Pfam:Med1 18 414 3.7e-112 PFAM
low complexity region 536 559 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 667 678 N/A INTRINSIC
low complexity region 960 981 N/A INTRINSIC
low complexity region 989 999 N/A INTRINSIC
low complexity region 1015 1036 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1063 1138 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1205 1243 N/A INTRINSIC
low complexity region 1250 1281 N/A INTRINSIC
low complexity region 1344 1364 N/A INTRINSIC
low complexity region 1482 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092735
SMART Domains Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160

DomainStartEndE-ValueType
Pfam:Med1 33 429 1.2e-113 PFAM
transmembrane domain 585 607 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107545
AA Change: E1466G
SMART Domains Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160
AA Change: E1466G

DomainStartEndE-ValueType
Pfam:Med1 59 426 2.9e-74 PFAM
low complexity region 551 574 N/A INTRINSIC
low complexity region 610 634 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 975 996 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
low complexity region 1030 1051 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1078 1153 N/A INTRINSIC
low complexity region 1185 1198 N/A INTRINSIC
low complexity region 1220 1258 N/A INTRINSIC
low complexity region 1265 1296 N/A INTRINSIC
low complexity region 1359 1379 N/A INTRINSIC
low complexity region 1497 1518 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Ppm1b T C 17: 85,013,569 S380P probably benign Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Med1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Med1 APN 11 98155684 intron probably benign
IGL00690:Med1 APN 11 98169400 missense possibly damaging 0.94
IGL01087:Med1 APN 11 98180285 missense probably damaging 1.00
IGL01133:Med1 APN 11 98157986 nonsense probably null
IGL02223:Med1 APN 11 98157876 missense probably damaging 1.00
IGL02257:Med1 APN 11 98180270 missense probably damaging 0.98
IGL02699:Med1 APN 11 98180025 missense possibly damaging 0.61
IGL02706:Med1 APN 11 98156707 intron probably benign
IGL02902:Med1 APN 11 98156509 intron probably benign
IGL02986:Med1 APN 11 98156260 intron probably benign
IGL03011:Med1 APN 11 98161033 missense possibly damaging 0.92
IGL03282:Med1 APN 11 98156817 missense probably damaging 1.00
IGL03303:Med1 APN 11 98158352 missense probably damaging 1.00
IGL03342:Med1 APN 11 98189180 critical splice donor site probably null
IGL03410:Med1 APN 11 98189183 missense possibly damaging 0.62
PIT4453001:Med1 UTSW 11 98158417 missense probably benign 0.40
R0040:Med1 UTSW 11 98166255 critical splice donor site probably null
R0206:Med1 UTSW 11 98155689 intron probably benign
R0206:Med1 UTSW 11 98155689 intron probably benign
R0208:Med1 UTSW 11 98155689 intron probably benign
R0310:Med1 UTSW 11 98167574 missense probably benign 0.38
R0505:Med1 UTSW 11 98156904 missense probably damaging 1.00
R0597:Med1 UTSW 11 98169438 missense probably benign 0.08
R0680:Med1 UTSW 11 98180166 intron probably null
R0686:Med1 UTSW 11 98158404 missense probably damaging 1.00
R0698:Med1 UTSW 11 98155689 intron probably benign
R1293:Med1 UTSW 11 98157036 missense possibly damaging 0.93
R1302:Med1 UTSW 11 98157449 missense possibly damaging 0.50
R1365:Med1 UTSW 11 98155995 intron probably benign
R1537:Med1 UTSW 11 98160946 missense probably damaging 0.97
R1609:Med1 UTSW 11 98161170 missense possibly damaging 0.91
R1631:Med1 UTSW 11 98155626 intron probably benign
R1792:Med1 UTSW 11 98157283 missense probably damaging 1.00
R1831:Med1 UTSW 11 98156611 intron probably benign
R1837:Med1 UTSW 11 98169412 missense probably damaging 1.00
R2366:Med1 UTSW 11 98161182 missense probably damaging 0.98
R3754:Med1 UTSW 11 98166722 missense possibly damaging 0.77
R3762:Med1 UTSW 11 98155515 intron probably benign
R4012:Med1 UTSW 11 98171706 missense possibly damaging 0.85
R4112:Med1 UTSW 11 98180087 missense probably damaging 1.00
R4384:Med1 UTSW 11 98152862 unclassified probably benign
R4579:Med1 UTSW 11 98158422 missense possibly damaging 0.56
R4740:Med1 UTSW 11 98180264 nonsense probably null
R4819:Med1 UTSW 11 98155432 intron probably benign
R4879:Med1 UTSW 11 98155360 unclassified probably benign
R4993:Med1 UTSW 11 98163904 missense probably damaging 1.00
R5040:Med1 UTSW 11 98155404 intron probably benign
R5249:Med1 UTSW 11 98157240 missense probably benign 0.43
R5373:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5374:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5552:Med1 UTSW 11 98166331 nonsense probably null
R5692:Med1 UTSW 11 98156380 intron probably benign
R6010:Med1 UTSW 11 98158362 missense probably damaging 1.00
R6149:Med1 UTSW 11 98183853 missense possibly damaging 0.74
R6417:Med1 UTSW 11 98157228 missense probably damaging 0.97
R7301:Med1 UTSW 11 98152808 missense probably benign 0.23
R7507:Med1 UTSW 11 98158026 missense probably damaging 1.00
R7529:Med1 UTSW 11 98155965 missense unknown
R7654:Med1 UTSW 11 98169363 missense possibly damaging 0.75
R7662:Med1 UTSW 11 98155392 missense unknown
R7679:Med1 UTSW 11 98156061 missense unknown
R7862:Med1 UTSW 11 98161210 missense probably benign 0.05
Z1176:Med1 UTSW 11 98161183 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATTTGTCACAGACGCCGTCG -3'
(R):5'- AAGTGACGCTACAGAAACCTGG -3'

Sequencing Primer
(F):5'- AAATGGGGGATTTCGACCAGTTC -3'
(R):5'- TACAGAAACCTGGAGAAAGTGGTG -3'
Posted On2019-10-24