Incidental Mutation 'R7588:Dock5'
ID 587282
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms 1110060D06Rik, rlc, lr2
MMRRC Submission 045636-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.389) question?
Stock # R7588 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 67989584-68170891 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 68000607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably null
Transcript: ENSMUST00000039135
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2b1 T A 11: 83,215,348 (GRCm39) D97E probably benign Het
Apbb1 G T 7: 105,223,173 (GRCm39) P146Q probably benign Het
Aste1 T A 9: 105,274,590 (GRCm39) S277T possibly damaging Het
Bnip5 T C 17: 29,124,430 (GRCm39) K291E probably benign Het
Cdk15 A G 1: 59,383,458 (GRCm39) D415G possibly damaging Het
Cep152 T A 2: 125,411,546 (GRCm39) E1256D probably damaging Het
Chd7 A G 4: 8,864,039 (GRCm39) N2643S probably damaging Het
Copg2 A G 6: 30,788,526 (GRCm39) probably null Het
D130043K22Rik T A 13: 25,071,876 (GRCm39) I940N probably damaging Het
Dnmt3a A G 12: 3,946,080 (GRCm39) T312A possibly damaging Het
Fam83g A T 11: 61,575,522 (GRCm39) I55F probably damaging Het
Fanci T C 7: 79,084,017 (GRCm39) F780L possibly damaging Het
Fhod3 G T 18: 25,223,305 (GRCm39) A884S probably benign Het
Gas6 T C 8: 13,516,711 (GRCm39) S596G probably benign Het
Gns T C 10: 121,226,563 (GRCm39) V404A probably benign Het
Gpatch1 T C 7: 34,991,173 (GRCm39) N624D probably damaging Het
Hmcn1 T C 1: 150,532,885 (GRCm39) I3099M possibly damaging Het
Itga1 A T 13: 115,104,785 (GRCm39) S1080R possibly damaging Het
Kcnk15 T C 2: 163,700,226 (GRCm39) V155A probably damaging Het
Luzp2 T A 7: 54,724,838 (GRCm39) probably null Het
Mapk8ip1 T A 2: 92,216,984 (GRCm39) D446V possibly damaging Het
Med1 T C 11: 98,046,398 (GRCm39) E1466G unknown Het
Mug1 A G 6: 121,852,476 (GRCm39) R855G probably damaging Het
Naalad2 C A 9: 18,262,775 (GRCm39) V374F probably damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nlrp5 A G 7: 23,107,576 (GRCm39) E83G probably benign Het
Nod2 T C 8: 89,401,536 (GRCm39) F901S possibly damaging Het
Nps T C 7: 134,870,508 (GRCm39) V10A probably benign Het
Pbrm1 T A 14: 30,806,900 (GRCm39) V1109E probably damaging Het
Pcdh7 A G 5: 57,877,246 (GRCm39) D267G probably damaging Het
Pfkp A G 13: 6,698,673 (GRCm39) Y15H possibly damaging Het
Pgap6 T C 17: 26,341,017 (GRCm39) Y176H probably damaging Het
Ppm1b T C 17: 85,320,997 (GRCm39) S380P probably benign Het
Psg21 T C 7: 18,381,134 (GRCm39) N470D probably benign Het
Qrich2 T C 11: 116,356,763 (GRCm39) N29D possibly damaging Het
Reln T C 5: 22,090,566 (GRCm39) T3431A probably benign Het
Rfc1 A G 5: 65,429,850 (GRCm39) V852A probably damaging Het
Rttn T G 18: 89,082,353 (GRCm39) D1426E probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Styxl1 G A 5: 135,799,130 (GRCm39) P28L probably damaging Het
Tcl1b4 A G 12: 105,168,641 (GRCm39) probably benign Het
Trav17 A G 14: 54,044,302 (GRCm39) D24G probably benign Het
Trim28 A C 7: 12,763,347 (GRCm39) D496A probably damaging Het
Trim29 T C 9: 43,246,425 (GRCm39) Y574H probably damaging Het
Trip12 G T 1: 84,738,604 (GRCm39) F750L probably damaging Het
Ubr3 C A 2: 69,801,513 (GRCm39) T1007K probably damaging Het
Zzz3 A G 3: 152,128,405 (GRCm39) Y7C possibly damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 68,024,338 (GRCm39) splice site probably benign
IGL00930:Dock5 APN 14 68,008,526 (GRCm39) missense probably damaging 1.00
IGL01525:Dock5 APN 14 68,043,169 (GRCm39) splice site probably benign
IGL01759:Dock5 APN 14 68,118,708 (GRCm39) nonsense probably null
IGL01941:Dock5 APN 14 68,049,681 (GRCm39) missense probably damaging 1.00
IGL02025:Dock5 APN 14 68,000,736 (GRCm39) missense probably damaging 1.00
IGL02093:Dock5 APN 14 68,076,992 (GRCm39) splice site probably benign
IGL02179:Dock5 APN 14 68,043,945 (GRCm39) splice site probably benign
IGL02208:Dock5 APN 14 68,065,899 (GRCm39) missense probably benign 0.06
IGL02605:Dock5 APN 14 68,065,887 (GRCm39) missense probably benign 0.18
IGL02608:Dock5 APN 14 68,065,888 (GRCm39) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,994,667 (GRCm39) splice site probably benign
IGL02971:Dock5 APN 14 67,994,558 (GRCm39) missense probably null 1.00
IGL02983:Dock5 APN 14 68,002,119 (GRCm39) missense probably damaging 1.00
IGL03151:Dock5 APN 14 68,103,516 (GRCm39) missense probably damaging 1.00
IGL03410:Dock5 APN 14 68,083,535 (GRCm39) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 68,062,123 (GRCm39) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 68,083,530 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0112:Dock5 UTSW 14 68,057,090 (GRCm39) missense probably benign
R0127:Dock5 UTSW 14 68,083,491 (GRCm39) missense probably benign 0.13
R0144:Dock5 UTSW 14 68,023,735 (GRCm39) missense probably benign 0.18
R0312:Dock5 UTSW 14 68,033,440 (GRCm39) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0364:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0496:Dock5 UTSW 14 68,054,967 (GRCm39) missense probably damaging 1.00
R0506:Dock5 UTSW 14 68,022,241 (GRCm39) splice site probably benign
R0586:Dock5 UTSW 14 68,046,481 (GRCm39) missense probably damaging 1.00
R0597:Dock5 UTSW 14 68,022,383 (GRCm39) splice site probably null
R0625:Dock5 UTSW 14 68,078,612 (GRCm39) missense probably benign
R1109:Dock5 UTSW 14 68,043,927 (GRCm39) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,996,610 (GRCm39) missense probably benign 0.00
R1278:Dock5 UTSW 14 68,077,015 (GRCm39) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 68,083,511 (GRCm39) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,994,584 (GRCm39) nonsense probably null
R1946:Dock5 UTSW 14 68,023,765 (GRCm39) missense probably damaging 1.00
R2046:Dock5 UTSW 14 68,049,591 (GRCm39) missense probably benign
R2101:Dock5 UTSW 14 68,031,459 (GRCm39) missense probably benign 0.02
R2252:Dock5 UTSW 14 68,022,261 (GRCm39) missense probably damaging 0.98
R2882:Dock5 UTSW 14 68,077,069 (GRCm39) missense probably damaging 0.99
R3110:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,993,941 (GRCm39) missense probably benign 0.02
R4242:Dock5 UTSW 14 68,065,939 (GRCm39) missense probably benign 0.19
R4244:Dock5 UTSW 14 68,012,031 (GRCm39) missense probably benign 0.41
R4646:Dock5 UTSW 14 68,080,228 (GRCm39) missense probably benign 0.01
R4793:Dock5 UTSW 14 68,037,803 (GRCm39) missense probably benign 0.26
R4841:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R4842:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R5159:Dock5 UTSW 14 68,029,738 (GRCm39) missense probably benign 0.04
R5164:Dock5 UTSW 14 68,055,110 (GRCm39) nonsense probably null
R5206:Dock5 UTSW 14 68,000,633 (GRCm39) missense probably benign 0.35
R5207:Dock5 UTSW 14 68,013,733 (GRCm39) missense probably benign 0.06
R5322:Dock5 UTSW 14 68,007,715 (GRCm39) missense probably benign 0.41
R5374:Dock5 UTSW 14 68,043,205 (GRCm39) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 68,002,104 (GRCm39) missense probably damaging 1.00
R5476:Dock5 UTSW 14 68,051,456 (GRCm39) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 68,040,535 (GRCm39) missense probably benign 0.01
R5677:Dock5 UTSW 14 68,015,052 (GRCm39) missense probably benign 0.00
R5773:Dock5 UTSW 14 68,033,507 (GRCm39) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 68,078,550 (GRCm39) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 68,095,443 (GRCm39) missense probably benign
R6154:Dock5 UTSW 14 68,097,361 (GRCm39) missense probably benign 0.03
R6268:Dock5 UTSW 14 68,027,724 (GRCm39) nonsense probably null
R6393:Dock5 UTSW 14 68,060,051 (GRCm39) missense probably benign 0.32
R6512:Dock5 UTSW 14 68,062,097 (GRCm39) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 68,033,445 (GRCm39) missense probably benign 0.00
R7012:Dock5 UTSW 14 68,060,035 (GRCm39) missense probably damaging 1.00
R7061:Dock5 UTSW 14 68,007,703 (GRCm39) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,993,919 (GRCm39) missense probably damaging 1.00
R7200:Dock5 UTSW 14 68,009,151 (GRCm39) nonsense probably null
R7311:Dock5 UTSW 14 68,065,951 (GRCm39) missense probably benign 0.25
R7359:Dock5 UTSW 14 68,003,337 (GRCm39) missense probably benign 0.10
R7422:Dock5 UTSW 14 68,046,479 (GRCm39) missense probably benign 0.01
R7637:Dock5 UTSW 14 68,023,789 (GRCm39) missense possibly damaging 0.95
R7709:Dock5 UTSW 14 68,033,454 (GRCm39) missense probably benign 0.44
R7763:Dock5 UTSW 14 68,058,776 (GRCm39) missense probably damaging 0.97
R8044:Dock5 UTSW 14 68,062,141 (GRCm39) missense probably damaging 1.00
R8076:Dock5 UTSW 14 68,040,426 (GRCm39) splice site probably null
R8168:Dock5 UTSW 14 68,007,646 (GRCm39) splice site probably null
R8353:Dock5 UTSW 14 68,054,957 (GRCm39) splice site probably null
R8480:Dock5 UTSW 14 68,073,859 (GRCm39) missense probably benign 0.32
R8535:Dock5 UTSW 14 68,031,425 (GRCm39) missense probably benign 0.19
R8708:Dock5 UTSW 14 68,004,820 (GRCm39) missense probably benign 0.02
R8732:Dock5 UTSW 14 68,083,449 (GRCm39) missense possibly damaging 0.85
R8888:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 68,083,439 (GRCm39) nonsense probably null
R8962:Dock5 UTSW 14 67,994,640 (GRCm39) missense probably benign
R8972:Dock5 UTSW 14 68,013,749 (GRCm39) missense probably damaging 1.00
R9244:Dock5 UTSW 14 67,996,563 (GRCm39) missense probably damaging 0.99
R9345:Dock5 UTSW 14 68,060,071 (GRCm39) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 68,018,450 (GRCm39) missense probably damaging 1.00
X0023:Dock5 UTSW 14 68,008,537 (GRCm39) missense probably benign 0.15
Z1177:Dock5 UTSW 14 68,051,382 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATTAAGCTGTGCTCACCAGG -3'
(R):5'- TTTCAGCCACCCAGCATGAC -3'

Sequencing Primer
(F):5'- CTGTGCTCACCAGGTGTTTG -3'
(R):5'- CACCCAGCATGACAGAGAGG -3'
Posted On 2019-10-24