Incidental Mutation 'R7588:Pgap6'
ID 587284
Institutional Source Beutler Lab
Gene Symbol Pgap6
Ensembl Gene ENSMUSG00000024180
Gene Name post-glycosylphosphatidylinositol attachment to proteins 6
Synonyms Rxylt1, Tmem8, M83
MMRRC Submission 045636-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7588 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 26332290-26342228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26341017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 176 (Y176H)
Ref Sequence ENSEMBL: ENSMUSP00000121651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
AlphaFold Q9ESN3
Predicted Effect probably damaging
Transcript: ENSMUST00000025010
AA Change: Y707H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: Y707H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000128597
AA Change: Y176H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180
AA Change: Y176H

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2b1 T A 11: 83,215,348 (GRCm39) D97E probably benign Het
Apbb1 G T 7: 105,223,173 (GRCm39) P146Q probably benign Het
Aste1 T A 9: 105,274,590 (GRCm39) S277T possibly damaging Het
Bnip5 T C 17: 29,124,430 (GRCm39) K291E probably benign Het
Cdk15 A G 1: 59,383,458 (GRCm39) D415G possibly damaging Het
Cep152 T A 2: 125,411,546 (GRCm39) E1256D probably damaging Het
Chd7 A G 4: 8,864,039 (GRCm39) N2643S probably damaging Het
Copg2 A G 6: 30,788,526 (GRCm39) probably null Het
D130043K22Rik T A 13: 25,071,876 (GRCm39) I940N probably damaging Het
Dnmt3a A G 12: 3,946,080 (GRCm39) T312A possibly damaging Het
Dock5 A G 14: 68,000,607 (GRCm39) probably null Het
Fam83g A T 11: 61,575,522 (GRCm39) I55F probably damaging Het
Fanci T C 7: 79,084,017 (GRCm39) F780L possibly damaging Het
Fhod3 G T 18: 25,223,305 (GRCm39) A884S probably benign Het
Gas6 T C 8: 13,516,711 (GRCm39) S596G probably benign Het
Gns T C 10: 121,226,563 (GRCm39) V404A probably benign Het
Gpatch1 T C 7: 34,991,173 (GRCm39) N624D probably damaging Het
Hmcn1 T C 1: 150,532,885 (GRCm39) I3099M possibly damaging Het
Itga1 A T 13: 115,104,785 (GRCm39) S1080R possibly damaging Het
Kcnk15 T C 2: 163,700,226 (GRCm39) V155A probably damaging Het
Luzp2 T A 7: 54,724,838 (GRCm39) probably null Het
Mapk8ip1 T A 2: 92,216,984 (GRCm39) D446V possibly damaging Het
Med1 T C 11: 98,046,398 (GRCm39) E1466G unknown Het
Mug1 A G 6: 121,852,476 (GRCm39) R855G probably damaging Het
Naalad2 C A 9: 18,262,775 (GRCm39) V374F probably damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nlrp5 A G 7: 23,107,576 (GRCm39) E83G probably benign Het
Nod2 T C 8: 89,401,536 (GRCm39) F901S possibly damaging Het
Nps T C 7: 134,870,508 (GRCm39) V10A probably benign Het
Pbrm1 T A 14: 30,806,900 (GRCm39) V1109E probably damaging Het
Pcdh7 A G 5: 57,877,246 (GRCm39) D267G probably damaging Het
Pfkp A G 13: 6,698,673 (GRCm39) Y15H possibly damaging Het
Ppm1b T C 17: 85,320,997 (GRCm39) S380P probably benign Het
Psg21 T C 7: 18,381,134 (GRCm39) N470D probably benign Het
Qrich2 T C 11: 116,356,763 (GRCm39) N29D possibly damaging Het
Reln T C 5: 22,090,566 (GRCm39) T3431A probably benign Het
Rfc1 A G 5: 65,429,850 (GRCm39) V852A probably damaging Het
Rttn T G 18: 89,082,353 (GRCm39) D1426E probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Styxl1 G A 5: 135,799,130 (GRCm39) P28L probably damaging Het
Tcl1b4 A G 12: 105,168,641 (GRCm39) probably benign Het
Trav17 A G 14: 54,044,302 (GRCm39) D24G probably benign Het
Trim28 A C 7: 12,763,347 (GRCm39) D496A probably damaging Het
Trim29 T C 9: 43,246,425 (GRCm39) Y574H probably damaging Het
Trip12 G T 1: 84,738,604 (GRCm39) F750L probably damaging Het
Ubr3 C A 2: 69,801,513 (GRCm39) T1007K probably damaging Het
Zzz3 A G 3: 152,128,405 (GRCm39) Y7C possibly damaging Het
Other mutations in Pgap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pgap6 APN 17 26,336,493 (GRCm39) missense probably damaging 0.96
IGL01014:Pgap6 APN 17 26,335,983 (GRCm39) unclassified probably benign
IGL02167:Pgap6 APN 17 26,338,045 (GRCm39) missense probably damaging 1.00
IGL02375:Pgap6 APN 17 26,338,473 (GRCm39) missense probably benign 0.05
IGL02892:Pgap6 APN 17 26,338,094 (GRCm39) missense probably damaging 1.00
IGL02931:Pgap6 APN 17 26,336,923 (GRCm39) missense probably benign
IGL03005:Pgap6 APN 17 26,337,911 (GRCm39) missense probably benign 0.01
IGL03124:Pgap6 APN 17 26,335,808 (GRCm39) missense probably damaging 0.98
IGL03046:Pgap6 UTSW 17 26,338,414 (GRCm39) splice site probably null
R0551:Pgap6 UTSW 17 26,339,576 (GRCm39) missense probably damaging 1.00
R0555:Pgap6 UTSW 17 26,336,088 (GRCm39) missense probably benign 0.19
R1502:Pgap6 UTSW 17 26,339,290 (GRCm39) missense possibly damaging 0.82
R1593:Pgap6 UTSW 17 26,337,381 (GRCm39) missense possibly damaging 0.63
R1688:Pgap6 UTSW 17 26,337,882 (GRCm39) missense possibly damaging 0.94
R1829:Pgap6 UTSW 17 26,341,194 (GRCm39) missense probably damaging 1.00
R2071:Pgap6 UTSW 17 26,341,017 (GRCm39) missense probably damaging 1.00
R2117:Pgap6 UTSW 17 26,336,858 (GRCm39) missense possibly damaging 0.67
R3609:Pgap6 UTSW 17 26,337,860 (GRCm39) missense probably benign 0.23
R3610:Pgap6 UTSW 17 26,337,860 (GRCm39) missense probably benign 0.23
R4564:Pgap6 UTSW 17 26,336,837 (GRCm39) missense possibly damaging 0.80
R4749:Pgap6 UTSW 17 26,335,757 (GRCm39) missense probably damaging 1.00
R4777:Pgap6 UTSW 17 26,340,515 (GRCm39) missense probably damaging 1.00
R4913:Pgap6 UTSW 17 26,339,513 (GRCm39) missense probably damaging 1.00
R5098:Pgap6 UTSW 17 26,337,902 (GRCm39) missense probably damaging 1.00
R5126:Pgap6 UTSW 17 26,340,614 (GRCm39) missense probably damaging 0.99
R5640:Pgap6 UTSW 17 26,337,846 (GRCm39) missense possibly damaging 0.50
R5722:Pgap6 UTSW 17 26,339,536 (GRCm39) frame shift probably null
R5723:Pgap6 UTSW 17 26,339,536 (GRCm39) frame shift probably null
R5739:Pgap6 UTSW 17 26,339,425 (GRCm39) missense probably damaging 1.00
R5927:Pgap6 UTSW 17 26,340,972 (GRCm39) missense probably benign 0.34
R6587:Pgap6 UTSW 17 26,340,538 (GRCm39) missense probably benign 0.03
R6723:Pgap6 UTSW 17 26,339,610 (GRCm39) missense probably damaging 0.96
R7621:Pgap6 UTSW 17 26,336,865 (GRCm39) missense probably benign 0.00
R7653:Pgap6 UTSW 17 26,339,423 (GRCm39) missense probably damaging 1.00
R7771:Pgap6 UTSW 17 26,341,047 (GRCm39) missense probably damaging 1.00
R8037:Pgap6 UTSW 17 26,336,509 (GRCm39) missense possibly damaging 0.63
R8493:Pgap6 UTSW 17 26,340,931 (GRCm39) missense probably damaging 1.00
R8956:Pgap6 UTSW 17 26,339,374 (GRCm39) missense possibly damaging 0.89
R9048:Pgap6 UTSW 17 26,340,515 (GRCm39) missense probably damaging 1.00
R9574:Pgap6 UTSW 17 26,337,861 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCCAGATCTAGATAGACCC -3'
(R):5'- TCAGGTGTCCATGAACCAGC -3'

Sequencing Primer
(F):5'- TAGATAGACCCCATACCTCTTGG -3'
(R):5'- AGCCTTATCAGGTCACTGTGTACAAC -3'
Posted On 2019-10-24