Incidental Mutation 'R7588:Ppm1b'
ID587286
Institutional Source Beutler Lab
Gene Symbol Ppm1b
Ensembl Gene ENSMUSG00000061130
Gene Nameprotein phosphatase 1B, magnesium dependent, beta isoform
SynonymsPP2CB
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7588 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location84956741-85023991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85013569 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 380 (S380P)
Ref Sequence ENSEMBL: ENSMUSP00000079107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080217] [ENSMUST00000112304] [ENSMUST00000112305] [ENSMUST00000112307]
Predicted Effect probably benign
Transcript: ENSMUST00000080217
AA Change: S380P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079107
Gene: ENSMUSG00000061130
AA Change: S380P

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 9e-16 BLAST
low complexity region 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112304
SMART Domains Protein: ENSMUSP00000107923
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 6e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112305
SMART Domains Protein: ENSMUSP00000107924
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 6e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112307
SMART Domains Protein: ENSMUSP00000107926
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 5e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO results in early pre-implantation lethality. A hypomorphic mutation results in increased sensitivity to Tnf-induced necroptosis and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,905,456 K291E probably benign Het
Ap2b1 T A 11: 83,324,522 D97E probably benign Het
Apbb1 G T 7: 105,573,966 P146Q probably benign Het
Aste1 T A 9: 105,397,391 S277T possibly damaging Het
Cdk15 A G 1: 59,344,299 D415G possibly damaging Het
Cep152 T A 2: 125,569,626 E1256D probably damaging Het
Chd7 A G 4: 8,864,039 N2643S probably damaging Het
Copg2 A G 6: 30,811,591 probably null Het
D130043K22Rik T A 13: 24,887,893 I940N probably damaging Het
Dnmt3a A G 12: 3,896,080 T312A possibly damaging Het
Dock5 A G 14: 67,763,158 probably null Het
Fam83g A T 11: 61,684,696 I55F probably damaging Het
Fanci T C 7: 79,434,269 F780L possibly damaging Het
Fhod3 G T 18: 25,090,248 A884S probably benign Het
Gas6 T C 8: 13,466,711 S596G probably benign Het
Gns T C 10: 121,390,658 V404A probably benign Het
Gpatch1 T C 7: 35,291,748 N624D probably damaging Het
Hmcn1 T C 1: 150,657,134 I3099M possibly damaging Het
Itga1 A T 13: 114,968,249 S1080R possibly damaging Het
Kcnk15 T C 2: 163,858,306 V155A probably damaging Het
Luzp2 T A 7: 55,075,090 probably null Het
Mapk8ip1 T A 2: 92,386,639 D446V possibly damaging Het
Med1 T C 11: 98,155,572 E1466G unknown Het
Mug1 A G 6: 121,875,517 R855G probably damaging Het
Naalad2 C A 9: 18,351,479 V374F probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nlrp5 A G 7: 23,408,151 E83G probably benign Het
Nod2 T C 8: 88,674,908 F901S possibly damaging Het
Nps T C 7: 135,268,779 V10A probably benign Het
Pbrm1 T A 14: 31,084,943 V1109E probably damaging Het
Pcdh7 A G 5: 57,719,904 D267G probably damaging Het
Pfkp A G 13: 6,648,637 Y15H possibly damaging Het
Psg21 T C 7: 18,647,209 N470D probably benign Het
Qrich2 T C 11: 116,465,937 N29D possibly damaging Het
Reln T C 5: 21,885,568 T3431A probably benign Het
Rfc1 A G 5: 65,272,507 V852A probably damaging Het
Rttn T G 18: 89,064,229 D1426E probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Styxl1 G A 5: 135,770,276 P28L probably damaging Het
Tcl1b4 A G 12: 105,202,382 probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trav17 A G 14: 53,806,845 D24G probably benign Het
Trim28 A C 7: 13,029,420 D496A probably damaging Het
Trim29 T C 9: 43,335,128 Y574H probably damaging Het
Trip12 G T 1: 84,760,883 F750L probably damaging Het
Ubr3 C A 2: 69,971,169 T1007K probably damaging Het
Zzz3 A G 3: 152,422,768 Y7C possibly damaging Het
Other mutations in Ppm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Ppm1b APN 17 85003284 missense probably damaging 1.00
IGL01923:Ppm1b APN 17 84994061 missense probably damaging 0.98
IGL02974:Ppm1b APN 17 84993824 missense possibly damaging 0.92
R0190:Ppm1b UTSW 17 84994103 missense probably damaging 1.00
R0576:Ppm1b UTSW 17 85013559 splice site probably null
R1848:Ppm1b UTSW 17 84994124 missense probably benign 0.00
R2018:Ppm1b UTSW 17 84994202 missense probably damaging 1.00
R2179:Ppm1b UTSW 17 84994434 missense probably damaging 1.00
R3053:Ppm1b UTSW 17 85013846 missense probably benign 0.00
R3085:Ppm1b UTSW 17 85013860 missense probably benign
R4387:Ppm1b UTSW 17 85015419 missense probably benign
R5353:Ppm1b UTSW 17 84994109 missense probably benign 0.17
R5738:Ppm1b UTSW 17 84993946 missense probably benign 0.14
R5818:Ppm1b UTSW 17 84993719 missense probably benign 0.01
Z1176:Ppm1b UTSW 17 84994265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAAACTGGTTTGTGGTAATTGGC -3'
(R):5'- TGGGTTTCCACCATCACTG -3'

Sequencing Primer
(F):5'- CTGCACAGGTAAGAACTGA -3'
(R):5'- GGTTTCCACCATCACTGTTCGAAG -3'
Posted On2019-10-24