Incidental Mutation 'R0622:Gys1'
ID 58729
Institutional Source Beutler Lab
Gene Symbol Gys1
Ensembl Gene ENSMUSG00000003865
Gene Name glycogen synthase 1, muscle
Synonyms Gys3, MGS
MMRRC Submission 038811-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0622 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 45434844-45456619 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45439995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 193 (T193S)
Ref Sequence ENSEMBL: ENSMUSP00000148252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003964] [ENSMUST00000211150] [ENSMUST00000211214]
AlphaFold Q9Z1E4
Predicted Effect probably damaging
Transcript: ENSMUST00000003964
AA Change: T257S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003964
Gene: ENSMUSG00000003865
AA Change: T257S

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glyco_transf_5 28 274 5.2e-8 PFAM
Pfam:Glycogen_syn 31 663 N/A PFAM
low complexity region 670 686 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
low complexity region 716 733 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211150
AA Change: T193S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211214
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the addition of glucose monomers to the growing glycogen molecule through the formation of alpha-1,4-glycoside linkages. Mutations in this gene are associated with muscle glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display neonatal lethality due to impaired cardiac function and exhibit reduced reduced ventricular chamber size, dilated atria, vascular congestion, and liver hemorrhage. Mice homozygous for a knock-in allele show altered glycogen homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T A 13: 30,381,681 M243K probably benign Het
Ap1b1 A G 11: 5,037,707 M744V probably damaging Het
C87977 T C 4: 144,213,013 probably benign Het
Ccdc152 T C 15: 3,298,178 N39S probably damaging Het
Cd163 G A 6: 124,317,352 V490M probably damaging Het
Col6a5 G T 9: 105,925,852 H1305N unknown Het
Cpb1 C A 3: 20,249,818 D361Y probably damaging Het
Dchs1 T A 7: 105,763,449 Y1248F probably damaging Het
Dhdds G C 4: 133,994,236 F83L probably damaging Het
Dsg4 T A 18: 20,449,788 V161E possibly damaging Het
Exosc4 A G 15: 76,327,536 D15G probably damaging Het
F3 A T 3: 121,725,019 D44V probably damaging Het
Fat2 A T 11: 55,283,128 F2253Y probably damaging Het
Fbn1 T C 2: 125,379,024 D650G possibly damaging Het
Gramd4 T A 15: 86,091,389 F36I probably damaging Het
Grm7 G A 6: 111,358,496 A623T probably damaging Het
Hectd4 A G 5: 121,348,625 T3228A possibly damaging Het
Itpk1 G T 12: 102,573,980 D281E probably damaging Het
Kcnh7 A C 2: 62,837,289 probably null Het
Klhl29 A G 12: 5,081,224 L852P probably damaging Het
Lrch1 T C 14: 74,796,051 Y509C probably benign Het
Lrp1b A G 2: 41,728,551 probably null Het
Mcpt4 C A 14: 56,060,662 R144L probably benign Het
Mia2 C T 12: 59,131,578 R12W probably damaging Het
Mrps5 A G 2: 127,594,531 K116R probably benign Het
Myrf G A 19: 10,223,452 P286S probably damaging Het
Nanp A G 2: 151,039,244 M28T probably benign Het
Neb T C 2: 52,212,951 I4472V probably benign Het
Nfix A C 8: 84,726,482 N314K probably damaging Het
Nlrc3 C T 16: 3,953,968 R849Q probably benign Het
Nup210l G A 3: 90,167,740 V786M probably damaging Het
Olfr1346 T C 7: 6,474,599 I163T possibly damaging Het
Olfr314 T C 11: 58,786,341 S36P probably damaging Het
Olfr600 A G 7: 103,346,857 S24P probably damaging Het
Olfr898 A G 9: 38,349,371 N96S possibly damaging Het
Pdia4 A T 6: 47,806,518 F197Y probably damaging Het
Phldb1 T C 9: 44,715,852 D432G probably damaging Het
Pik3ca A G 3: 32,436,552 E116G probably damaging Het
Polq T C 16: 37,060,993 V1173A probably benign Het
Pou2f3 C T 9: 43,125,119 R423H probably damaging Het
Prkag2 T C 5: 24,869,249 N246S probably damaging Het
Proser1 A G 3: 53,477,860 S388G probably benign Het
Ralgps1 G A 2: 33,174,447 R238* probably null Het
Rfx2 T C 17: 56,777,071 D657G probably damaging Het
Ryr3 A G 2: 112,662,555 F3724S probably damaging Het
Sh2d5 T C 4: 138,259,228 S421P probably damaging Het
Slc17a2 C A 13: 23,812,611 T33K probably damaging Het
St8sia5 A G 18: 77,246,113 T156A probably damaging Het
Stk32c T C 7: 139,188,110 D85G probably benign Het
Tnks A G 8: 34,940,822 S251P probably damaging Het
Tnxb T A 17: 34,718,729 L3864Q probably damaging Het
Trim9 A G 12: 70,346,604 Y189H probably damaging Het
Vmn1r77 T G 7: 12,041,388 F30L probably benign Het
Wasf3 A G 5: 146,466,792 probably null Het
Wdr90 C T 17: 25,855,658 C603Y probably damaging Het
Zdhhc25 T C 15: 88,601,107 L215P probably damaging Het
Zeb1 C T 18: 5,759,123 Q140* probably null Het
Zfp677 C T 17: 21,397,700 L340F probably benign Het
Other mutations in Gys1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gys1 APN 7 45444832 missense possibly damaging 0.88
IGL00870:Gys1 APN 7 45448013 critical splice donor site probably null
IGL01346:Gys1 APN 7 45442537 missense probably damaging 1.00
IGL02396:Gys1 APN 7 45439588 missense probably damaging 1.00
IGL03157:Gys1 APN 7 45439899 unclassified probably benign
IGL03196:Gys1 APN 7 45454817 splice site probably benign
R0095:Gys1 UTSW 7 45444649 missense possibly damaging 0.87
R0284:Gys1 UTSW 7 45436719 unclassified probably benign
R0537:Gys1 UTSW 7 45440001 missense probably damaging 1.00
R1749:Gys1 UTSW 7 45440032 missense probably damaging 1.00
R1968:Gys1 UTSW 7 45443546 missense probably damaging 1.00
R3953:Gys1 UTSW 7 45440046 missense probably damaging 1.00
R4058:Gys1 UTSW 7 45448386 splice site probably benign
R4626:Gys1 UTSW 7 45439534 missense probably damaging 1.00
R4661:Gys1 UTSW 7 45454834 missense probably damaging 1.00
R4998:Gys1 UTSW 7 45451544 intron probably benign
R5965:Gys1 UTSW 7 45455339 missense probably benign 0.25
R5987:Gys1 UTSW 7 45438105 missense probably benign 0.00
R6059:Gys1 UTSW 7 45455288 splice site probably null
R6481:Gys1 UTSW 7 45442969 missense possibly damaging 0.63
R6788:Gys1 UTSW 7 45444678 missense probably damaging 0.99
R6924:Gys1 UTSW 7 45443635 critical splice donor site probably null
R7006:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7029:Gys1 UTSW 7 45439584 missense possibly damaging 0.93
R7060:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7211:Gys1 UTSW 7 45448260 missense possibly damaging 0.88
R7237:Gys1 UTSW 7 45455162 missense probably benign 0.02
R7242:Gys1 UTSW 7 45439668 splice site probably null
R7593:Gys1 UTSW 7 45442936 missense probably damaging 0.99
R7641:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7674:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7756:Gys1 UTSW 7 45448302 missense probably benign 0.43
R8197:Gys1 UTSW 7 45442924 missense possibly damaging 0.80
R9082:Gys1 UTSW 7 45439493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTGTGAGACAGCCCAAAGCCC -3'
(R):5'- TCCTTCAGGATACAGAGTCAGCCAG -3'

Sequencing Primer
(F):5'- ATCGTGCTCCTAAGAGTGCAG -3'
(R):5'- AGAGTCAGCCAGCTTCATTTAC -3'
Posted On 2013-07-11