Incidental Mutation 'R7589:Aox1'
ID587291
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58041484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 31 (R31W)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably damaging
Transcript: ENSMUST00000001027
AA Change: R31W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: R31W

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8179:Aox1 UTSW 1 58097958 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
R8415:Aox1 UTSW 1 58041479 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGATGTGCCCATGAGTGG -3'
(R):5'- GCTCACGAAAAGTTGCACAC -3'

Sequencing Primer
(F):5'- CGCCTCAGGGAACAGTGATG -3'
(R):5'- AAGTTGCACACTCACATTCCTC -3'
Posted On2019-10-24