Incidental Mutation 'R7589:Fmo9'
ID587293
Institutional Source Beutler Lab
Gene Symbol Fmo9
Ensembl Gene ENSMUSG00000026560
Gene Nameflavin containing monooxygenase 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location166662055-166681845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 166674428 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 209 (K209N)
Ref Sequence ENSEMBL: ENSMUSP00000027843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027843] [ENSMUST00000148677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027843
AA Change: K209N

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027843
Gene: ENSMUSG00000026560
AA Change: K209N

DomainStartEndE-ValueType
Pfam:FMO-like 3 535 1.2e-252 PFAM
Pfam:Pyr_redox_2 4 262 2.9e-12 PFAM
Pfam:Pyr_redox_3 7 221 2.3e-14 PFAM
Pfam:NAD_binding_8 8 83 1.2e-6 PFAM
Pfam:K_oxygenase 77 334 8.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148677
AA Change: K158N

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114750
Gene: ENSMUSG00000026560
AA Change: K158N

DomainStartEndE-ValueType
Pfam:FMO-like 1 484 1.6e-222 PFAM
Pfam:Pyr_redox_3 3 170 1.2e-12 PFAM
Pfam:K_oxygenase 28 283 6.2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Fmo9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Fmo9 APN 1 166680145 splice site probably null
IGL01796:Fmo9 APN 1 166663335 missense probably benign 0.31
IGL03005:Fmo9 APN 1 166674519 missense probably benign 0.02
IGL03115:Fmo9 APN 1 166677651 missense probably damaging 1.00
IGL03163:Fmo9 APN 1 166674450 missense possibly damaging 0.77
R0089:Fmo9 UTSW 1 166667309 missense probably benign 0.05
R0570:Fmo9 UTSW 1 166674462 missense probably null 0.00
R1520:Fmo9 UTSW 1 166667455 missense probably benign 0.19
R1779:Fmo9 UTSW 1 166663299 missense probably benign 0.18
R1783:Fmo9 UTSW 1 166673648 missense probably benign 0.01
R2858:Fmo9 UTSW 1 166673667 missense probably damaging 1.00
R2859:Fmo9 UTSW 1 166673667 missense probably damaging 1.00
R3851:Fmo9 UTSW 1 166663367 missense probably benign 0.00
R3924:Fmo9 UTSW 1 166664652 missense probably benign 0.03
R4470:Fmo9 UTSW 1 166680230 missense probably damaging 1.00
R4728:Fmo9 UTSW 1 166663311 missense possibly damaging 0.82
R5538:Fmo9 UTSW 1 166673629 missense probably benign 0.01
R5650:Fmo9 UTSW 1 166663446 missense probably damaging 1.00
R5820:Fmo9 UTSW 1 166664601 missense possibly damaging 0.67
R6163:Fmo9 UTSW 1 166667393 missense probably benign
R6229:Fmo9 UTSW 1 166677557 missense possibly damaging 0.64
R6243:Fmo9 UTSW 1 166667369 missense probably benign 0.45
R6375:Fmo9 UTSW 1 166664595 critical splice donor site probably null
R7144:Fmo9 UTSW 1 166677620 missense probably benign 0.40
R7236:Fmo9 UTSW 1 166676571 missense probably damaging 1.00
R7316:Fmo9 UTSW 1 166663646 missense probably benign 0.21
R7341:Fmo9 UTSW 1 166676546 missense probably damaging 1.00
R7382:Fmo9 UTSW 1 166663660 splice site probably null
R7679:Fmo9 UTSW 1 166667489 missense probably benign 0.01
R8110:Fmo9 UTSW 1 166663526 missense probably benign 0.03
Z1088:Fmo9 UTSW 1 166673545 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCGTGCTTTACCTATCTAGTGACC -3'
(R):5'- GTGAAAGTTGTCCTCAGAATGAC -3'

Sequencing Primer
(F):5'- ACACGTAGGTCAGTTGTTTATATGCC -3'
(R):5'- GACAAATTATTCTCTTCCACCACAGG -3'
Posted On2019-10-24