Incidental Mutation 'R7589:Kif28'
ID587294
Institutional Source Beutler Lab
Gene Symbol Kif28
Ensembl Gene ENSMUSG00000087236
Gene Namekinesin family member 28
SynonymsLOC383592, Gm1305
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location179695297-179745271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 179731400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 248 (V248I)
Ref Sequence ENSEMBL: ENSMUSP00000152770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131716] [ENSMUST00000211943] [ENSMUST00000221136]
Predicted Effect
SMART Domains Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236
AA Change: V248I

DomainStartEndE-ValueType
KISc 3 331 1.02e-120 SMART
low complexity region 343 354 N/A INTRINSIC
FHA 424 473 1.12e-3 SMART
Pfam:KIF1B 615 654 1.3e-7 PFAM
low complexity region 842 857 N/A INTRINSIC
low complexity region 959 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211943
AA Change: V248I

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000221136
AA Change: V248I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Kif28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Kif28 APN 1 179702516 missense probably damaging 1.00
IGL00581:Kif28 APN 1 179739957 missense probably benign 0.14
R0348:Kif28 UTSW 1 179731253 missense probably damaging 1.00
R0388:Kif28 UTSW 1 179740089 missense possibly damaging 0.71
R0412:Kif28 UTSW 1 179702526 missense probably benign 0.01
R0788:Kif28 UTSW 1 179705223 unclassified probably benign
R0960:Kif28 UTSW 1 179695805 nonsense probably null
R1365:Kif28 UTSW 1 179739987 nonsense probably null
R1420:Kif28 UTSW 1 179702397 missense probably damaging 1.00
R1442:Kif28 UTSW 1 179705132 missense possibly damaging 0.73
R1507:Kif28 UTSW 1 179736006 missense probably damaging 1.00
R1818:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1819:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1903:Kif28 UTSW 1 179702523 missense possibly damaging 0.63
R2221:Kif28 UTSW 1 179733111 missense possibly damaging 0.80
R2358:Kif28 UTSW 1 179709459 missense probably damaging 1.00
R4916:Kif28 UTSW 1 179702520 missense probably benign 0.09
R4943:Kif28 UTSW 1 179713951 missense probably benign 0.02
R4967:Kif28 UTSW 1 179708442 missense probably damaging 1.00
R4974:Kif28 UTSW 1 179698644 missense probably damaging 0.98
R5152:Kif28 UTSW 1 179702538 missense probably damaging 1.00
R5382:Kif28 UTSW 1 179700282 missense probably damaging 1.00
R5649:Kif28 UTSW 1 179697771 splice site probably null
R5999:Kif28 UTSW 1 179695790 missense probably damaging 1.00
R6017:Kif28 UTSW 1 179699453 missense probably benign 0.24
R6180:Kif28 UTSW 1 179697772 splice site probably null
R6875:Kif28 UTSW 1 179735994 missense probably damaging 0.98
R7400:Kif28 UTSW 1 179700274 missense probably damaging 1.00
R7402:Kif28 UTSW 1 179740079 missense probably benign 0.00
R7530:Kif28 UTSW 1 179708480 missense probably benign 0.31
R7648:Kif28 UTSW 1 179709424 missense possibly damaging 0.89
R7815:Kif28 UTSW 1 179735983 missense probably damaging 1.00
R8030:Kif28 UTSW 1 179699064 missense probably benign 0.04
R8050:Kif28 UTSW 1 179709449 missense probably benign 0.00
R8088:Kif28 UTSW 1 179700354 missense probably damaging 1.00
R8781:Kif28 UTSW 1 179697916 missense probably benign 0.00
R8947:Kif28 UTSW 1 179716755 missense possibly damaging 0.94
R9011:Kif28 UTSW 1 179702419 missense possibly damaging 0.89
Z1176:Kif28 UTSW 1 179733134 missense probably benign 0.05
Z1177:Kif28 UTSW 1 179728219 missense not run
Predicted Primers PCR Primer
(F):5'- CGCTCGTCACATACCTGATG -3'
(R):5'- CTGTCCACTATGTCTCTGCAAAAG -3'

Sequencing Primer
(F):5'- TGATGACGTTCCCTAAACTGG -3'
(R):5'- AGGACACTTGGACCTGGG -3'
Posted On2019-10-24