Incidental Mutation 'R7589:Olfr1282'
ID587298
Institutional Source Beutler Lab
Gene Symbol Olfr1282
Ensembl Gene ENSMUSG00000096554
Gene Nameolfactory receptor 1282
SynonymsMOR248-2, Olfr1557, GA_x6K02T2Q125-72387537-72386620, MOR248-16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111335159-111336076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111335374 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 235 (K235E)
Ref Sequence ENSEMBL: ENSMUSP00000097213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099618] [ENSMUST00000208176]
Predicted Effect probably damaging
Transcript: ENSMUST00000099618
AA Change: K235E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097213
Gene: ENSMUSG00000096554
AA Change: K235E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.5e-47 PFAM
Pfam:7tm_1 41 287 2.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208176
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Prnp A G 2: 131,936,866 D146G probably benign Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Olfr1282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Olfr1282 APN 2 111335802 missense probably damaging 1.00
R0798:Olfr1282 UTSW 2 111335344 missense probably benign 0.16
R0932:Olfr1282 UTSW 2 111335198 missense probably benign 0.00
R0972:Olfr1282 UTSW 2 111335418 missense probably benign 0.18
R1033:Olfr1282 UTSW 2 111335802 missense probably damaging 1.00
R1864:Olfr1282 UTSW 2 111335707 missense possibly damaging 0.95
R1879:Olfr1282 UTSW 2 111335463 missense possibly damaging 0.61
R2343:Olfr1282 UTSW 2 111335700 missense probably damaging 1.00
R2509:Olfr1282 UTSW 2 111335731 missense probably damaging 0.98
R3620:Olfr1282 UTSW 2 111335344 missense probably benign 0.06
R5589:Olfr1282 UTSW 2 111335505 missense possibly damaging 0.46
R6487:Olfr1282 UTSW 2 111335667 missense probably benign 0.00
R6818:Olfr1282 UTSW 2 111335314 missense probably benign 0.22
R7153:Olfr1282 UTSW 2 111335901 missense probably damaging 1.00
R7480:Olfr1282 UTSW 2 111335392 missense probably benign 0.22
R8441:Olfr1282 UTSW 2 111335786 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTACCTACCAATAGCTTTGAG -3'
(R):5'- TGGACCTAGAGTGATAGACAGC -3'

Sequencing Primer
(F):5'- TCAGAATTCACTTGTGACTTATGAG -3'
(R):5'- GACCTAGAGTGATAGACAGCTTTTTC -3'
Posted On2019-10-24