Incidental Mutation 'R7589:Prnp'
ID587299
Institutional Source Beutler Lab
Gene Symbol Prnp
Ensembl Gene ENSMUSG00000079037
Gene Nameprion protein
SynonymsPrPC, Sinc, Prn-i, PrP, CD230, Prn-p, PrPSc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R7589 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location131909928-131938429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131936866 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000088833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091288] [ENSMUST00000124100] [ENSMUST00000136783]
PDB Structure
PRION PROTEIN DOMAIN PRP(121-231) FROM MOUSE, NMR, 2 MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
mouse prion protein fragment 121-231 [SOLUTION NMR]
Mouse Prion Protein with mutation N174T [SOLUTION NMR]
mouse prion protein with mutations S170N and N174T [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation S170N [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutations Y225A and Y226A [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation V166A [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutation D167S [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutations D167S and N173K [SOLUTION NMR]
Mouse prion protein (121-231) containing the substitution Y169G [SOLUTION NMR]
>> 11 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000091288
AA Change: D146G

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088833
Gene: ENSMUSG00000079037
AA Change: D146G

DomainStartEndE-ValueType
PRP 23 241 7.26e-181 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124100
SMART Domains Protein: ENSMUSP00000116195
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136783
SMART Domains Protein: ENSMUSP00000122345
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mutations at this locus affect resistance to scrapie infection and spongiform encephalopathy and/or alter scrapie incubation time. Homozygous mutants also show impaired locomotor coordination and reduced mitochondria numbers with unusual morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T G 7: 41,626,972 C700G probably damaging Het
4930486L24Rik T C 13: 60,842,933 K316E probably damaging Het
Akap6 A T 12: 53,142,063 K2087* probably null Het
Alpk2 A T 18: 65,300,073 H1320Q probably damaging Het
Aox1 A T 1: 58,041,484 R31W probably damaging Het
Asnsd1 G T 1: 53,347,967 A167E probably benign Het
Atg14 T C 14: 47,543,090 D409G probably benign Het
Atp13a3 T A 16: 30,344,615 E574D probably benign Het
Bicd1 A T 6: 149,513,667 Y626F possibly damaging Het
Cdc5l C T 17: 45,410,781 R521Q probably benign Het
Dglucy T C 12: 100,841,401 F160L probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fmo9 T A 1: 166,674,428 K209N possibly damaging Het
Gsdmc2 C A 15: 63,825,043 L426F probably damaging Het
Hip1 T C 5: 135,414,311 D956G probably benign Het
Kif28 C T 1: 179,731,400 V248I probably benign Het
Klk10 T C 7: 43,783,627 V149A probably benign Het
Krt40 G T 11: 99,540,157 N255K probably damaging Het
Map4k4 T A 1: 40,021,091 Y1013* probably null Het
Mcur1 T C 13: 43,551,625 Y185C probably damaging Het
Mzt1 T C 14: 99,036,512 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nkx1-2 T C 7: 132,599,475 I18V probably damaging Het
Ofcc1 T A 13: 40,255,484 Q155L probably benign Het
Olfr1239 A G 2: 89,418,380 V11A possibly damaging Het
Olfr1282 T C 2: 111,335,374 K235E probably damaging Het
Olfr1377 A T 11: 50,985,030 M110L probably damaging Het
Olfr1411 G A 1: 92,597,059 R180H probably benign Het
Olfr635 T C 7: 103,979,791 Y200H probably damaging Het
Rhbdf1 C T 11: 32,212,903 V455I probably benign Het
Rnf6 G A 5: 146,211,429 R260W possibly damaging Het
Rtl1 T C 12: 109,593,845 N520S possibly damaging Het
Setbp1 A T 18: 78,856,492 M1320K probably benign Het
Slc39a8 A G 3: 135,884,362 T338A probably damaging Het
Tcf4 A G 18: 69,682,819 *693W probably null Het
Ttc8 A T 12: 98,976,437 D412V probably damaging Het
Ush2a G T 1: 188,542,849 A1840S probably benign Het
Vmn1r60 A T 7: 5,544,689 S137R Het
Vmn1r91 T A 7: 20,101,877 H240Q probably benign Het
Vmn2r107 A T 17: 20,375,372 H729L probably benign Het
Yme1l1 C T 2: 23,160,262 T35I probably benign Het
Zfp292 A G 4: 34,806,777 V2094A probably damaging Het
Zfp934 A T 13: 62,518,316 N202K Het
Other mutations in Prnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Prnp APN 2 131937111 missense probably benign
IGL01081:Prnp APN 2 131936420 intron probably benign
IGL01820:Prnp APN 2 131937070 missense probably benign 0.05
R0837:Prnp UTSW 2 131936524 missense probably damaging 1.00
R2303:Prnp UTSW 2 131937126 missense probably benign 0.00
R5214:Prnp UTSW 2 131937004 missense probably damaging 1.00
R5562:Prnp UTSW 2 131937031 missense probably damaging 1.00
R6859:Prnp UTSW 2 131936788 missense possibly damaging 0.93
R8163:Prnp UTSW 2 131936988 missense probably benign 0.01
R8420:Prnp UTSW 2 131936749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGTGGACTGATGTCGGCC -3'
(R):5'- ATCATCTTCACATCGGTCTCGG -3'

Sequencing Primer
(F):5'- CTGATGTCGGCCTCTGCAAAAAG -3'
(R):5'- ATCGGTCTCGGTGAAGTTCTCC -3'
Posted On2019-10-24